Чем полезны корки граната: на что способен обычный гранат

Содержание

Гранат — целебный плод королевского дерева

Гранат необходимо включать в пищевой рацион и детей, и взрослых. В гранате содержится кладезь витаминов, но особенно богат этот удивительный плод   витаминами С, В6, В12 и Р (рутин).

  • Витамин С – известный антиоксидант, который способствует укреплению иммунной системы, ускоряет процесс заживления ран, нормализует проницаемость капилляров, оказывает влияние на синтез гормонов и белка коллагена, выводит токсины.
  • Витамин В 6 необходим для нормальной работы нервной системы, нормализует обменные процессы в тканях головного мозга, улучшает память, стабилизирует уровень глюкозы в крови.
  • Витамин В12 улучшает кроветворение, участвует в развитии эритроцитов и в формировании нервных волокон.
  • Здоровье сосудов поддерживает  витамин Р, который укрепляет стенки капилляров, снижает артериальное давление и нормализует сердечный ритм, а также обладает противоотёчным действием. Организм человека не способен вырабатывать этот витамин, поэтому необходимо обеспечить регулярное поступление витамина Р с продуктами питания.

Кроме витаминов и минеральных веществ, в гранате содержатся до 15 аминокислот, половина из которых являются незаменимыми для организма. Именно этот факт говорит в пользу того, чтобы полезный гранат включался в меню вегетарианцев и веганов.

В гранатовом соке есть яблочная, лимонная, винная, щавелевая, янтарная и борная кислоты. В связи с этим сок из граната способен оказывать лечебный эффект при мочекаменной и желчекаменной болезни.

  • При беременности гранат очень полезен, так как  богат комплексом минералов и витаминов, незаменимых аминокислот, содержащихся в нем, необходимых в этот период женщине. Беременные женщины, часто интуитивно, отдают предпочтение гранату, особенно во время токсикоза. Кроме того, гранат способен улучшать формулу крови и предупреждать анемию, которая иногда развивается в период беременности.
  • Гранатовый сок особенно широко используется, как эффективное средство, при анемии, поскольку он способен повышать уровень гемоглобина в крови. При малокровии сок, разведенный в пропорции 1:1 с водой, употребляют по 100 мл трижды в день за полчаса до еды. Через два месяца применения делают перерыв, после которого курс повторяют. Такое лечение соком не противопоказано даже при беременности, в отличие от сложных фитосборов с гранатом.

Обычно гранатовый сок рекомендуется разбавлять водой, поскольку в чистом виде он может вызвать раздражение слизистой оболочки желудка, провоцировать  запоры и неблагоприятно сказываться на состоянии зубной эмали, но даже при разбавлении в пропорции 1:1 сок граната повышает уровень гемоглобина в крови.

  • Свежевыжатый сок граната — натуральное жаропонижающее средство. При повышенной температуре и ознобе рекомендуется выпивать сок граната с медом. При сниженном аппетите, упадке сил и общей слабости, после тяжёлых заболеваний применяют сок семян граната по 50-70 мл 3-4 раза в день за полчаса до еды.

В связи с выраженным противовоспалительным, дезинфицирующим эффектом и наличием дубильных веществ,  отвар из кожуры плодов граната применяют при гингивите, стоматите и кровоточащих дёснах, в виде полосканий. Экстракт граната входит в состав некоторых зубных паст. Кожура плодов граната входит в разнообразные фитосборы.

  • При анемии хороший эффект достигается при применении растительного сбора следующего состава: кожура плодов граната, листья малины и земляники лесной, плоды шиповника и укропа, вахта,  мох исландский, шандра, листья крапивы и  череды, чистотел, зверобой и пустырника. Всех растительных ингредиентов взять поровну и тщательно перемешать. На 400 мл кипятка добавить 8 г сбора, нагревать на водяной бане в течение 15 минут, настоять 2 часа и принимать по 0,5 стакана три раза в сутки после еды.  Курс лечения до 4 месяцев.

При женских проблемах и аменорее делают фитосбор по той же схеме из кожуры плодов граната, травы зверобоя и спорыша, цветков ромашки и побегов черники, листьев подорожника, горчичника и манжетки, корневища дягиля и заманихи. 

При лечении гранатом необходимо учитывать, что фитотерапия является вспомогательным, комплиментарным методом и не заменяет основные назначения доктора при заболевании.

  • Кроме того, гранат не сочетается с некоторыми лекарственными препаратами, например, антигистаминными (противоаллергическими) и др. Поэтому фитотерапию желательно проводить отдельно от лечения синтетическими лекарственными средствами.

Противопоказанием к применению граната являются острые заболевания системы пищеварения (язва желудка или кишечника, гастрит в стадии обострения), склонность к запорам, повреждения зубной эмали.

В связи с тем, что в кожуре плодов граната содержатся алкалоиды, которые обладают токсичными свойствами при передозировке, не следует применять отвар из кожуры граната, который широко использует народная медицина, у детей, беременных женщин, ослабленных пациентов, при индивидуальной непереносимости. Несмотря на то, что отвары из граната пользуются популярностью у ценителей и последователей народной медицины, стоит ограничивать применение этого средства из-за содержащихся алкалоидов.

Тем не менее, нужно отметить, что грузинскими учеными были получены результаты клинических испытаний экстракта корок граната, которые показали положительный эффект при лечении энтеритов, в том числе хронического энтерита. 

 Валеолог отделения профилактики М. Верещагина

Гранатовые корки: польза гранатовой корки

26 февраля 2021

Поклонники вкусных и полезных фруктов наверняка знают о том, что гранат благоприятно влияет на состав крови и повышает иммунитет, но многие с легкостью выбрасывают кожуру, которая также является кладезем полезных веществ и своеобразным природным антисептиком. Еще в античные времена толченую корку использовали в качестве лекарства от гнойников и ожогов, а настойка на гранатовой корке прекрасно помогала унять боль в желудке и избавиться от проблем с кишечником.

Товары из этой статьи

Кожура граната: разбор химического состава

Согласно исследованиям китайских ученых, количество антиоксидантов в корке граната гораздо больше, чем в самых зернах. Особое внимание нужно уделить:

·         катехинам, которые способствуют появлению терпкого послевкусия и вяжущего действия;

·         микроэлементам, таким как марганец, калий, железо, селен, кобальт и т. п.;

·         флавоноидам и полифенолам, которые относятся к антиоксидантам и очищают сосуды от холестерина, снижая вероятность появления стенокардии и прочих проблем;

·         урсоловой кислоте и т. п.

 

Польза гранатовой корки

Лечебные свойства гранатовой корки действительно невероятны, ведь она используется как вяжущее средство, актуальное во время отравления, интоксикации и поноса. Полезная микрофлора самого кишечника не повреждается. Имеющиеся в составе антиоксиданты выводят из организма вредные вещества, в особенности гранатовые корки отлично демонстрируют свои свойства в процессе лечения печени.

Представители народной медицины нередко используют отвар из корок для избавления от глистов, для снятия воспалений, для тонизирования организма и успокоения нервной системы. Чтобы получить ранозаживляющий эффект, можно на рану положить ткань, смоченную водным настоем из корочек. Важно поддерживать примочку влажной и периодически обновлять смоченный материал на новый (рекомендуется использовать бинт либо стерильную вату). Чтобы ускорить регенерацию эпидермиса при ожоге, можно протереть рану гранатовым соком низкой концентрации и присыпать влажный ожог порошком.

 

В особенности отвары полезны при беременности, во время проблем с горлом или ротовой полостью, когда принятие классических лекарств или антибиотиков нежелательно. Сам рецепт приготовления вещества для употребления очень прост: нужно 20 г сухой корки граната залить 1,5 ст. кипятка и проварить на небольшом огне 30 минут. Полученную жидкость нужно процедить и дать немного остыть. Рекомендуется принимать вовнутрь по 2 чайные ложки не чаще, чем 2 раза в день.

Нередко отвар из корки используется в косметологической сфере, ведь созданный своими руками ополаскиватель позволяет укрепить волосы и избавиться от перхоти. В особенности подобное средство подойдет брюнеткам, поскольку ополаскиватель способствует более темному цвету волос. Не исключается измельчение кожуры и заливание ее розовой водой. Полученным средством можно протирать кожу лица, дабы избавиться от угревой сыпи либо предотвратить появление прыщиков. Подобный натуральный тоник также обладает омолаживающим эффектом и несколько разглаживает неглубокие морщины.

Хиты продаж в магазине

Противопоказания и вред

Применение или употребление гранатовой кожуры в любом виде не особо полезно в том случае, если человек страдает от:

·         аллергии на содержащиеся микроэлементы;

·         гепатита;

·         частых запоров;

·         геморроя в острой стадии или склонности к образованию трещин.

Категорически запрещается во время лечения настоями из кожуры принимать дополнительные препараты антигистаминного типа или пить водку/самогон. Важно придерживаться четко прописанной дозировки, ведь в случае попадания чрезмерного большого количества алкалоидов в организм могут появиться признаки отравления.

 

Популярные рецепты с гранатовой кожурой

Чай, заваренный из корок, способствует лечению кашля, особенно хронического. Для создания подобного напитка могут использоваться как сырые, так и сухие корки. Чтобы улучшить вкусовые характеристики, можно добавить травы, лимон, мед и прочие элементы, снижающие ощущение терпкости.

В борьбе с глистами можно взять 50 г корок и залить 0,5 л. холодной кипяченой воды. Важно настаивать будущее лекарство в течение 6 часов. После, необходимо прокипятить полученный настой до уменьшения количества жидкости, а после процеживания следует выпивать несколько глотков в течение 60 минут до еды. Через полчаса рекомендуется принять слабительное.

Важный момент: в качестве домашнего лекарства можно использовать только корочки, очищенные от белой внутренней кожуры. При наличии серьйозных проблем со здоровьем, лучше обратится к врачу.

Пользуются спросом после прочтения

Полезные свойства граната, косточек и кожуры. Омоложение

Декоративное растение гранатник дарит поздней осенью свои чудо-плоды — гранаты. Целебные свойства граната воспеваются со времен древнеиндийских манускриптов и греческих писаний. И в наши дни гранат не утратил свою популярность. Плоды граната, косточки и кожура очень полезны, обладают лечебными свойствами. Гранат содержит большое количество полифенолов, витамина С и ненасыщенных жирных кислот, которые влияют на выработку оксида азота. Это вещество улучшает проходимость кровеносных сосудов, что увеличивает кровообращение в организме, и предотвращает образование тромбов.

1. Одно из целебных свойств граната — борьба с анемией, плоды граната, гранатовый сок повышают гемоглобин. При малокровии употребляют разведенный гранатовый сок по 0,5 стакана 3 раза в день за 30 минут до еды в течение 2 месяцев.

2. Кора спелого граната содержит алкалоиды пельтьерин, изопельтьерин и метилизопельтьерин, которые обладают сильным противоглистным действием. Чтобы избавиться от глистов, настаивают 40—50 г измельченной коры в 400 г холодной воды в течение 6 часов, а затем кипятят на медленном огне, пока не выпарится половина жидкости. Остывший отвар процеживают и выпивают в течение часа мелкими порциями, через час выпивают слабительное, а через 4—5 часов делают клизму.

3. Полезные свойства граната, косточек, кожуры, их применение. Кожура и плоды граната обладают вяжущим свойством, поэтому их используют против поноса, при диарее, от колита и энтероколита. Кожуру граната сушат, измельчают и принимают, взрослые — по щепотке 3 раза в день после еды, а детям дают — свежеотжатый сок, разведенный наполовину водой. В случае инфекционной диареи, полифенолы, содержащиеся в кожуре граната, эффективно уменьшают рост дизентерийной палочки и других возбудителей.

4. Водный отвар из кожуры граната или его сок применяют для полоскания горла (при ангине и фарингите), полости рта (при гингивите и стоматите), Дезинфицирует рот и горло. Дубильные вещества снимают боль, а органические кислоты уничтожают инфекцию.

5. Плоды граната — полезны диабетикам. Для этого употребляют по 100 г сока 4 раза в день до еды.

6. Выводит радиацию. Сок граната очень полезен всем, кто работает с радиоактивными изотопами или живет в зоне повышенной радиации.

7. При жирной коже, угрях делают маску из слегка поджаренной, толченой кожуры граната смешанной со сливочным или оливковым маслом. Хранят эту смесь в холодильнике, наносят на кожу не чаще 2 раз в неделю. Порошком из высушенной кожуры можно эффективно лечить угревую сыпь на коже, ожоги, трещины и царапины.

8. Зернышки граната очень мягко снижают артериальное давление у гипертоников. А перепонки из плодов граната, высушенные и добавленные в чай, помогут успокоить нервную систему, избавиться от тревоги, наладить ночной сон.

9. Повышает активность гормонов. В косточках граната содержатся масла, которые восстанавливают гормональный баланс в организме. Поэтому гранатовые зернышки съедают, особенно они полезны при болезненных месячных, головных болях и климаксе.

10. При различных воспалительных заболеваниях (почек, печени, ушей и глаз, суставов, гинекологических органов) помогает отвар кожуры граната. 2 чайные ложки измельченной гранатовой кожуры заливают 1 стаканом горячей воды, кипятят на водяной бане 30 минут, процеживают, отжимают и разводят кипяченой водой до исходного количества. Принимают по 50 г 2—3 раза в день за 30 минут до еды.

Внимание:
Кожура граната содержит небольшое количество очень ядовитых веществ — алкалоидов. Никогда не превышайте дозировку отваров, иначе повышение давления, головокружение, ухудшение зрения и судороги. Кроме этого, органические кислоты сока граната могут сильно разрушить зубную эмаль. Поэтому всегда разбавляйте сок водой.

Водный настой сухих корок плодов Граната лечит многие болезни. Это универсальное природное лекарство: водный настой сухих корок плода граната. Оно излечивает от поражения любым штаммом при заболеваниях: Дизентерия, Сальмонеллез (известно около 400 штаммов), Холера, Брюшной тиф, Язва желудка и кишечника (тонкая кишка), Колит (толстая кишка), Дисбактериоз, Острый аппендицит и необходимсть в хирургической операции отпадает, лечатся таким настоем неделю.

Рецепт приготовления водного настоя сухих корок плода граната и его применения.

В предварительно подогретую чашку, стакан или стеклянную баночку положить примерно 10-12 г сухих корок плода граната и залить их 200 мл крутого кипятка (можно в эту тару налить 200 мл сырой воды, опустить 10-12 г гранатовых корок и электрокипятильником довести до кипения, но не кипятить). Накрыть и настоять 25-30 минут, потом можно пить по 20-25 мл за 1 приём. Пить натощак, причём 1-й приём утром, после сна, а 4-й приём на ночь, перед сном. Корки не выбрасывать, настаивание продолжается.

При этом лечении спиртное противопоказано. Сущность лечения состоит в том, что во всём желудочно-кишечном тракте постоянно подавляются все болезнетворные бактерии (здоровые бактерии не подавляются) и места их расположения успешно колонизируют здоровые, необходимые для человека бактерии.

Кроме перечисленного, известно, что Гиппократ лечил этим водным настоем резаные и колотые раны. На рану накладывалась чистая (х/б) тряпочка, предварительно смоченная в водном настое сухих корок плода граната. Эта тряпочка постоянно поддерживалась влажной до заживления раны.

Как можно использовать гранатовые корки

Применение кожуры граната – не такая и большая сложность, если знать общие правила, но в шкурке этого ценного плода содержится много алкалоидов, поэтому при переизбытке продукта можно запросто получить отравление. Впрочем, как известно с древности, даже яды лечат в адекватных дозах, а самые полезные вещества в больших объемах представляют собой смертельную опасность. Разберемся, как использовать гранат правильно и с пользой для себя, не подвергаясь риску.

Зачем нужен гранат?

Не только его шкурка, но и сами зернышки, отжимаемый из них сок имеют множество положительных качеств, позитивно влияющих на здоровье человека. Включение граната в разных формах в повседневный рацион – залог долголетия и здоровой жизни. Плод окажет поддержку при избавлении от широкого спектра недугов – но нужно знать, как использовать кожуру граната, зернышки правильно, с максимальной выгодой для себя.

Что внутри?

Прежде чем разбираться с полезными свойствами корок граната, стоит вникнуть в причину того, почему они так хороши. Обусловлено это химическим составом уникального плода, богатством компонентов, содержащихся как в шкурке, так и во внутренней части. С давних пор человечество знает, что, кроме внутренних вкусных зернышек, пользу приносят и шкурка, и перепонки, и даже листья дерева. Отжимают из граната масло, широко используемое при самых разных проблемах со здоровьем и просто для своего удовольствия.

Полезные свойства корок граната объясняются их ценностью и составом. Всего на сто граммов приходится 14 гр углеводов, 0,7 гр белка и 0,6 гр жиров. В составе присутствуют фруктоза, глюкоза, незаменимые для человеческого организма пищевые волокна и органические кислоты, а также жирные. В кожуре плода много витаминов, микроэлементов. Особенно ценны запасы витаминов А, Е, К и никотиновой кислоты. Богата кожура и витаминными соединениями из группы В, включая фолиевую кислоту в количестве 40 мкг. При правильном использовании в пищу граната из его шкурки можно получить фосфор, калий, йод, цинк и множество других исключительно важных микроэлементов. Врачи отмечают наличие холина, бета-каротина, незаменимых аминокислот.

А в чем польза?

Зная, чем полезна кожура граната, можно всерьез подойти к оформлению меню с участием этого продукта. В настоящее время разработаны методы использования в кулинарии всех частей ягод, и кожура в большей степени пригодны для полезных для здоровья рецептов, нежели для вкусового удовольствия. Обусловлено это следующими качествами:

  • способность бороться с воспалениями, инфекциями;
  • активизация иммунитета, выработка организмом способности противостоять патогенным микроскопическим форма жизни;
  • стимуляция работы почек, за счет чего ткани быстрее очищаются от токсинов;
  • нормализация стула при диарее;
  • инициирование процессов продуцирования желчи.

Список не исчерпан

Чем полезна кожура граната еще? Этот продукт борется с атеросклерозом и помогает ослабить болевой синдром разной природы, немного разжижает кровь и даже позволяет предупредить формирование опухолей, наростов. Правильное использование корок в пище помогает бороться с патогенными колониями микроорганизмов – их рост угнетается, постепенно популяция вымирает.

Гранат имеет выраженный ранозаживляющий эффект, стимулирует регенеративные процессы на клеточном уровне, поэтому после полного заживления не остается следов даже в виде незначительных шрамов. Поможет кожура граната от глистов, иных инвазий и инфицирования, некоторых вирусов. Отвар на основе продукта тонизирует организм в целом, укрепляет защитные силы и активизирует человека. Особенно яркий эффект заметен по иммунной системе. Кроме отвара кожуры, можно употреблять в пищу сок, свежие ягоды.

Кому актуально?

Рекомендовано регулярно пить отвар из кожуры граната в период смены сезонов, когда человек в наибольшей степени страдает от авитаминоза. Если пришлось пережить тяжелое заболевание, продукты из плода помогут восстановить организм. Правильное использование ягод позволяет восполнить запасы важных для нормального функционирования организма микроэлементов.

Рекомендовано употреблять в пищу свежий гранат и настои, отвары из его корок в период восстановления после хирургического вмешательства. Поможет чай из кожуры граната при общем ослаблении. Во многом это связано с высокой концентрацией в продукте витамина С, который оказывает положительное влияние на иммунитет человека. Выражается это в повышении стойкости к простудным заболеваниям. А вот витамины группы В улучшают состояние зрительной, нервной системы, памяти.

На что обратить внимание?

Лечебные свойства кожуры граната во многом объясняются достаточно большим количествам железа, витамина В2 – за их счет активизируется производство в клетках организма гемоглобина, предотвращается анемия. Никотиновая кислота, в свою очередь, нормализует психическое, эмоциональное состояние человека. Рекомендуют использовать отвары, чаи с гранатом в ситуациях сильного стресса, нервных потрясений или депрессионных расстройств. Полезный чай – эффективное средство против нарушений сна, тревожности, нервозности, повышенной раздражительности и даже агрессивности.

Лечебные свойства кожуры граната в некоторой степени объясняются повышенной концентрацией антиоксидантов в продукте, включая витамины А, Е. Если организм получает эти соединения в достаточном количестве, замедляются процессы старения, что сказывается не только на внешнем виде, но и общем состоянии организма. При регулярном употреблении напитков на гранатовых шкурках приходят в норму волосы, ногти, кожа, улучшается зрение, растет общий тонус.

Можно или нет?

Как и любой другой продукт, влияющий на здоровье человека, имеет кожура граната и противопоказания. Лечебные свойства не будут полезными, если злоупотреблять ими в слишком большом объеме. Есть вероятность аллергической реакции – многое зависит от особенностей конкретного организма. В кожуре присутствуют токсичные вещества, которые в повышенной концентрации могут вызвать слабое или даже сильное отравление. Чтобы не столкнуться с таким неприятным эффектом, придется тщательно следовать рекомендациям относительно концентрации корок на литр воды, а также соблюдать установленную частоту приема напитков.

Чтобы не столкнуться с самыми неприятными проявлениями, нужно учитывать не только противопоказания кожуры граната. Лечебные свойства проявляются при использовании продукта с учетом особенностей организма больного: возраста, веса, индивидуальных отличительных качеств. Если, предположим, речь идет о маленьком ребенке, то при нарушениях стула ему следует пять раз ежедневно использовать в пищу чайную ложку отвара, а вот в школьном возрасте – столовую. Дозировку, соответствующую разрешенной во взрослом возрасте, допускают с 12 лет. При несоблюдении таких правил можно столкнуться с ухудшением ситуации: отравлением организма и побочными реакциями.

Специальный случай

Лечебные свойства кожуры граната можно проверять с очень большой осторожностью в период выкашивания плода, выкармливания ребенка. Лучше предварительно посоветоваться с доктором, только после его рекомендаций начинать курс лечения. Если нет возможности проконсультироваться, имеет смысл отказаться от такой программы, чтобы не навредить себе и ребенку.

Не стоит проверять на себе лечебные свойства граната, если есть склонность к запорам, геморрой или беспокоят трещины кишки. Почечные заболевания накладывают запрет на употребление в пищу граната в любой форме. Настои, отвары корок не следует использовать, если есть повышенная вероятность кровотечений, высок шанс аллергической реакции. Народные целители обращают внимание, что в большинстве случаев использование препаратов на базе гранатовых шкурок не провоцирует побочных реакций, но нужно быть аккуратным. Особенно категоричный запрет связан с приемом антигистаминных препаратов: они категорически не сочетаются с отварами, настоями кожуры граната.

Важные особенности

Чтобы шкурка граната была действительно полезной, нужно хранить ее правильно, иначе все полезные вещества просто улетучатся, распадутся, и от напитка на такой основе не будет никакой пользы. При соблюдении правил срок годности заготовленных шкурок – несколько лет. Правила достаточно простые:

  • подходят только плотные плоды с толстой, цельной кожурой без повреждений;
  • перед заготовкой нужно внимательно осмотреть гранат: цвет шкурки должен быть натуральным, ровным;
  • пересушенная или слишком светлая кожура не подходит для отваров, настоев;
  • перед заготовкой шкурку снимают, аккуратно разрезая, убирая внутреннюю прослойку;
  • делят кожуру на небольшие кусочки и неделю просушивают, храня на салфетке под слоем марли;
  • в период сушки регулярно перемешивают корочки для равномерности процесса.

Готовый продукт хранят в бумажном пакете, стеклянной банке. Перед использованием измельчают в порошок ступкой, кофемолкой.

Как пользоваться: проблемы кишечника

Особенно эффективна кожура граната от поноса. Для приготовления рецепта предварительно высушенные корочки измельчают. Количество ингредиентов: на каждые пол-литра воды – столовая ложка порошка. Природный продукт и воду смешивают, 10 минут варят на слабом огне, еще несколько часов настаивают в закрытом термосе. В пищу необходимо использовать трижды ежедневно до еды. Для взрослых рекомендовано употреблять 50-100 мл за раз. Средство не только избавляет от поноса, но и очищает организм от токсинов, нормализует ЖКТ.

Для лечения детей можно воспользоваться другим рецептом. На чашку кипятка берут четверть шкурок небольшого граната, выжидают 40 минут (чашка должна быть плотно накрыта). Если поносом страдает малыш годовалого возраста или младше, в пищу необходимо трижды в сутки давать по чайной ложке полученного настоя. В более старшем возрасте при такой же дозировке увеличивают частоту по пяти раз. Для подростков можно выбрать другую дозировку – трижды ежедневно столовая ложка.

Гранат против кишечных инвазий

Один из самых популярных рецептов на гранатовых шкурках – настой, помогающий победить заражение глистами. Для приготовления необходимо иметь 50 гр порошка, сделанного из предварительного высушенных шкурок, но при отсутствии таковых можно использовать свежие. Порошок заливают 400 мл чистой воды, закрывают крышкой и выжидают четверть суток, после чего кипят весь объем, пока половина жидкости не испарится. Полученному отвару дают остыть, фильтруют и выпивают за час в несколько подходов. Еще через полчаса используют слабительное средство.

Никаких воспалений!

Процесс приготовления лекарства от воспалений – проще некуда: нарезают кожуру одного плода, заливают кипятком и час дают постоять на паровой бане, после чего жидкость сцеживают и пьют по четверть стакана перед едой дважды в сутки. Длительность такого курса – до полного выздоровления. Особенно хорошим будет результат, если воспалительный процесс поразил мочевой пузырь, почки, репродуктивные, дыхательные органы или кишечник.

Если воспаления наблюдаются в полости рта, горле, если болят десны, гранат можно применять по другой схеме: на чашку кипятка берут 20 гр шкурок плода, варят не более пяти минут, еще час выдерживают в термосе и фильтруют. Полученная жидкость подходит для регулярного ополаскивания полости рта. Длительность курса – не меньше недели, частота использования – до пяти раз ежедневно.

Гранатовый чай

Рецепт очень простой: в привычный и любимый человеком напиток добавляют небольшое количество корочек плода. Можно использовать как предварительно высушенные, так и свежие. Для усиления вкусовых и ароматических качеств, повышения пользы в напиток вводят мяту, лимон, иные травы, оказывающие положительное влияние на человеческое здоровье. Для подслащения лучше использовать мед. Готовый напиток приятно пахнет, немного терпкий и очень вкусный. Правда, важно придерживаться нормы: если корок граната будет слишком много, есть вероятность внезапного ухудшения самочувствия.

Это любопытно

Впервые в нашей стране официально рецепты с использование гранатовой кожуры были опубликованы в 1999 г. Разработанный препарат был предназначен для приведения в норму аппендикса, устранения инвазий сальмонеллы, рекомендовался при дизентерии и поносе. Этот рецепт с применением гранатовых корок был даже запатентован несколькими годами раньше – в 1996-м. Для выявления его эффективности были организованы клинические тесты в профильном медицинском учреждении.

А вы знали, что гранатовые корки, это эффективное очищающее средство от паразитов, токсинов, для лечения поноса, патологий сердечно -сосудистой системы и укрепления иммунитета? Читайте подробнее в этой статье

Гранатовые корки – полезные свойства и рецепты применения

Благородный гранат яркого багрового цвета во все времена считался королем фруктов. Несмотря на то, что в наших краях он не растет, фрукт ценится не меньше, чем в родных странах.

Что уж там говорить, плоды сами все скажут своим безупречным терпковатым вкусом.

На самом деле не только сочные плоды, но и кожура может оказаться полезной.

С помощью простых корок, которые мы привыкли выбрасывать, можно излечиться от многих патологий.

Полезные свойства гранатовых корок

Кожура граната издавна применяется в целебных целях, благодаря своим потрясающим возможностям:

  • остановка процессов окисления и выведение плохого холестерина, что служит отличной профилактикой сердечнососудистых патологий;
  • кожура мгновенно выводит токсины и способствует очищению печени;
  • за счет своих противовоспалительных способностей, кожура широко применяется для укрепления иммунитета и лечения простудных патологий;
  • чай из гранатовых корок прекрасно помогает избавляться от паразитов ( остриц, глистов и т.д)
  • средство на ура справляется с регенерацией кожи и способствует заживлению, поддерживает кости и зубы в хорошем состоянии, что объясняется большой концентрацией аскорбиновой кислоты;
  • составы с порошком граната способствуют остановке кровотечения;
  • многочисленными исследованиями была подтверждена эффективность корок граната в борьбе с онкологическими кожными заболеваниями;
  • порошок, который прожаривается на масле оливы, широко применяется в косметологии против различных высыпаний и прыщей. Помимо этого, состав применяется от ожогов, ссадин и поражений кожного покрова;
  • гранатовые корки — отличное средство от поноса.Отвар поможет решить проблему у детей и взрослых.
  • корки можно смело добавлять в чай. Такой напиток успокоит ваши нервы и поднимет настроение.

Помимо этого стоит отметить многочисленные косметические свойства универсального граната:

  • эллагеновая кислота эффективно увлажняет, делает кожу нежной, помогает от увядания;
  • далеко не всем известно, что гранат способен решить проблему облысения и перхоти, а с помощью настоя из гранатовых корок можно проводить ополаскивания волос, что может придать им красивый оттенок;
  • солнцезащитные вещества, входящие в состав кожицы, борются с ультрафиолетовым облучением;
  • смесь из кожуры и масла стимулирует продукцию проколлагена, что помогает надолго сохранить молодость кожи.

Как сушить гранатовые корки правильно?

Разумно полезные корочки заготавливать на будущее, ведь очень сложно найти в продаже такой специфический продукт.

Вымойте и протрите тщательно полотенцем фрукт, после чего очистите его от кожицы аккуратно, максимально избавляясь от мякоти.

После чего корочки мелко нарежьте и сушите в течении семи дней. Разложите все осторожно на салфетку и накройте слоем марли.

Несколько раз в день из перемешивайте, так как они очень быстро начинают портиться под воздействием влаги.

Сухие корки помещают в пакетах из бумаги и хранят в прохладном месте.

Как приготовить и пить напитки из корочек граната?

  • Настой из гранатовых корок

Как правило на основе гранатовых корок готовят настой. Для этого измельченные корки граната ( 1 ч.л ) заливаются стаканом кипятка и настаиваются 2 часа. Принимают средство по половине стакана.

Такое средство хорошо помогает при диарее (поносе) и обладает всеми вышеперечисленнмыи полезными свойствами .

При соблюдении рецептуры и правильном приготовлении настоя, вы забудете про расстройство кишечника сразу.

Огромным преимуществом продукта является то, что он подавляет пагубную микрофлору во всем ЖКТ и никак не влияет на полезные бактерии.

Рекомендуется все же повторить прием данного средства по истечении двух часов. Если ситуация слишком запущена, больному требуется более длительное лечение до трех дней.

Если вы лечите расстройство кишечника или другие патологии ЖКТ, вам необходимо пить настой четыре раза в день через одинаковый временной интервал. Впервые напиток выпивается натощак, а последняя порция должна быть выпита на ночь. Пейте отвар через день.

Корки граната – ограничения к применению

Как правило, гранатовые корки хорошо переносятся пациентами.

Но фанатически принимать средства народной медицины нельзя. Стоит понимать, что в корках содержится определенное количество токсинов.

Детям разрешается давать по маленькой ложечке настоя пять раз в день.

Школьники могут принимать уже по столовой ложке лекарства, а подростки могут употреблять средство для лечения взрослыми дозами.

С осторожностью следует лечиться корками людям, имеющим склонность к кровотечениям. Очень внимательными должны быть аллергики.

Подобное лечение не подходит людям, страдающим запорами, трещинами в анальном отверстии и геморроем.

Не стоит спешить выбрасывать кожуру из граната. Возможно, она вам пригодится, ведь у нее столько полезных свойств.

Гранат – вкусный популярный экзот. Его любят взрослые и дети, но съедобны только зернышки. Что делать с кожурой, мало кто знает. Почти всегда ее выбрасывают. И напрасно: гранатовые корки насыщены ценными компонентами, по ряду полезных свойств превосходят мякоть. Однако у корок граната полезные свойства и противопоказания дополняют друг друга. И об этом тоже нужно знать.

Состав гранатовой кожуры

У кожуры граната лечебные свойства обусловлены ее составом.

Из чего состоит кожура

Корки граната содержат большинство полезных компонентов, присутствующих в мякоти и зернах экзота:

  1. Натуральные антиоксиданты. Представлены витаминами А, С, Е. Они активируют жировой обмен, полезны для крови, сердца, кожи, десен. Выводят свободные радикалы, притормаживая старение организма. Ускоряют заживление порезов и ран. У корок их вдвое больше, чем у зерен.
  2. Урсоловая кислота. Главный жиросжигатель в организме. Тормозит онкологию, атеросклероз. Помогает работе сердца, контролирует сахар и холестерин в крови, укрепляет волосы, уничтожает перхоть. Это непременный элемент спортивного питания, поскольку держит тело в тонусе и помогает нарастить мышцы.
  3. Дубильные вещества. Им кожура (и другие компоненты граната) обязана вяжущим вкусом. Танины с катехинами составляют треть состава. Ценятся как противовоспалительные и останавливающие кровь, нормализуют работу желудочно-кишечного тракта, выводят токсины, тормозят размножение опасной микрофлоры. Это главный компонент, останавливающий диарею. Однако при избыточном потреблении эффект противоположный, то есть запор.
  4. Антоцианы. Это красящие соединения, благодаря которым гранат обретает фирменный цвет.

Оболочка граната содержит алкалоиды. Их намного меньше, чем у измельченной коры дерева – всего 5%, но вред может оказаться фатальным. Вот почему важно соблюдать дозировку средств из кожуры граната. От использования коры вообще отказались: слишком ядовита.

Минералы, витамины

Гранатовая кожура обладает целебными возможностями благодаря набору минералов:

В кожуре граната избыток витаминов А, Е, С, К. Представлен витаминный комплекс В: В3 (никотиновая кислота), В4 (холин), В9 (фолиевая кислота). Насыщенность железом предотвращает анемичность, улучшает качество крови.

Биологическая и питательная ценность

Пищевая ценность кожуры граната (г/на 100 г свежего продукта):

В составе кожуры граната обнаружены глюкоза, фруктоза, клетчатка (пищевые волокна), органические и жирные кислоты, бета-каротин.

Гранатовые корки полезные свойства

Чем полезна корка граната, досконально изучили на родине экзота, в Грузии.

Это антисептик, бактерицид, заживляющий, противоглистный препарат. Витаминно-минеральный комплекс корок граната укрепляет иммунитет, сердце, сосуды, препятствует проникновению вирусов в организм. Борется с атеросклерозом, ослабляет боль разной природы, выводит токсины из печени, разжижает кровь, тормозит онкологию.

Корки граната для ЖКТ

Главная миссия кожуры граната – оздоровление желудочно-кишечного тракта.

Препарат, созданный грузинскими учеными на основе экстракта из них, доказал эффективность при лечении взрослых и детей. Речь об энтерите, колитах (включая хроническую форму), поражениях внутренней оболочки кишечника, дизентерии.

Если медицинские препараты противопоказаны, подойдут народные средства. Отвары гранатовых корок – доказавшее эффективность средство при сбоях в работе кишечника, в первую очередь диарее, а также при дисбактериозе.

Корки граната для десен

Кожура граната хорошо лечит следующие недуги:

  • кровоточивость десен;
  • гингивит;
  • стоматит
  • ринит;
  • фарингит.

Применяется отвар для полоскания из кожуры экзота. Независимо от характера болезни, ротовая полость оздоравливается целиком.

Корки граната при ожогах

Изобилие аскорбиновой кислоты наделило гранат ранозаживляющим действием.
Регенерация запускается на уровне клеток, поэтому на зажившей коже нет даже маленьких шрамов.
Раны, порезы, ссадины или ожоги лечат порошком либо спиртовой настойкой кожуры фрукта.

Другие применения корок граната

Для корок экзота нашлось еще несколько сфер. Отвары, чаи помогают в таких ситуациях:

  • ослабленный иммунитет, склонность к простудным заболеваниям;
  • межсезонье, чтобы нейтрализовать авитаминоз или анемичность;
  • реабилитация после хирургической операции, тяжелого заболевания;
  • кровохаркание, обильные месячные;
  • ослабление зрения или памяти;
  • нервозность, вспыльчивость.

Отвары, чаи, другие продукты на основе гранатовых корок сохраняют минерально-витаминный баланс организма в проблемных ситуациях.

Народные лекари утверждают, что кожурой граната вылечиваются ЛОР-заболевания, печень, язва. Официальная наука ставит это под сомнение, поскольку в рецептах компоненты экзота дополняются другими ингредиентами. Однако роль гранатовых составляющих как эффективного вспомогательного средства доказана.

Как заготавливать гранатовые корки

Сушеная гранатовая кожура либо продукты из нее продаются в аптеках или интернет-магазинах. Но если хочется иметь их всегда под рукой и быть уверенным в качестве, для лечения лучше заготовить кожуру самостоятельно. Особенно в сезон фрукта.

Заготовка корок экзота включает несколько этапов:

  1. Выбор. Подойдут только сочные плоды, твердоватые с цельной кожурой яркого цвета. Она не должна быть очень сухой, пятнистой или бледной.
  2. Подготовка плодов. Гранаты моют и вытирают досуха. Кожуру осторожно срезают ножом, убирая белую мягкую прослойку: она дает горечь. Если это приветствуется, данный компонент можно оставить.
  3. Корочки экзота измельчают ножом или вручную.
  4. Сырье раскладывают на салфетке, бумаге (не газете, без рисунков) или доске, прикрывают марлей. Располагают на воздухе, но чтобы не попадали солнечные лучи. То есть в тени. Регулярно перемешивают, чтобы все просушилось равномерно. Обычно для полного высушивания хватает недели.
  5. Если корки нужно высушить срочно, используют духовку или электросушилку. Выставляют 45-50°.
  6. При любом способе сушки кондиции гранатовых корок проверяют одинаково. Если легко, с похрустыванием разламываются, – готовы.
  7. Можно измельчить все сырье сразу или часть, нужную в данный момент. Лучший результат даст кофемолка, но подойдет и ступка.
  8. Для хранения гранатовой кожуры выделяют плотно закрываемые емкости (стекло, бумага), которые держат в сухом затененном прохладном месте (13-23°С).

При соблюдении перечисленных условий сушеные корки граната сохраняют кондиции до трех лет.

Корки граната в народной медицине

Есть простые, но эффективные лечебные средства из гранатовой кожуры. Главное знать пропорции и соблюдать технологию изготовления отвара, чая или другого водного настоя сухих корок.

Чай с корками граната

Чай с корками от граната заваривается как обычный. Подходят сухие или свежие, главное, чтобы кусочки корочек были не слишком крупными.

Чай получается душистый, но терпковатый. Поэтому можно разбавить гранатовые корки лимонной кожурой, мятой, мелиссой, другими травами по собственному вкусу. Поле для экспериментирования широкое. Сладкоежкам понравится вариант меда к гранатовому чаю.

У тех, кто постоянно пьет гранатовый чай, красивые волосы, ногти, кожа. Человек замечает, что стал крепче, бодрее, лучше чувствует себя.

Такой чай полезно заварить и пить при стрессе, душевном потрясении. Он помогает одолеть депрессию, бессонницу, тревожность, раздражительность, вспышки агрессии. Особенно помогает его прием на ночь.

Отвар при поносах и расстройствах ЖКТ

Гранат от поноса помогает в любом возрасте. Проверенный рецепт – отвар из сухих измельченных корок граната от диареи.
Для детей до 12 лет. Столовую ложку гранатовых корок заливают 190-210 мл кипятка, накрывают крышкой. Через 35-45 минут средство готово.
При расстройствах ЖКТ у детей дозировка следующая:

  • грудничкам достаточно трех приемов по чайной ложке;
  • детям постарше, до дошкольников включительно, дают чайную ложку 4-5 раз в сутки;
  • в возрасте 7-11 лет нужна столовая ложка трижды в день.

В тяжелых случаях отвар из гранатовых корок от поноса детям потребуется принимать два-три дня. Первую порцию нужно выпивать утром натощак, финальную на ночь.

Для детей старше 12 лет и взрослых. Понадобятся корки граната, вода, термос. Берут столовую ложку корок на 0,5 л воды. Смесь кипятят 10-11 минут на малом огне. Отвар настаивается в термосе около двух часов. Норма приема у взрослых и подростков при диарее – трижды в день до еды по 60-120 мл.

Алкоголь в эти дни запрещен.
Средство прекращает понос, попутно избавляя организм от токсинов. Подавляется только вредная микрофлора кишечника, что нормализует работу ЖКТ.

Для больных десен горла и воспалений во рту

Заболевания ротовой полости лечат гранатовым отваром. Понадобится 20-25 г корок граната на 210-270 мл воды. Смесь кипятят пять-шесть минут, настаивают в термосе минимум час, процеживают. Полоскания ежедневны, по пять-шесть раз. Для излечения обычно хватает пяти-восьми дней.

Другие виды воспалений

Если воспалительным процессом охвачены ЖКТ, мочеполовая, репродуктивная система, почки, в лечении применяют лекарство по такому рецепту.

Кожуру плода средних габаритов измельчают, заливают кипятком, отправляют на паровую баню (на 55-60 минут). Жидкость осторожно сливают. Пьют до еды по 50-60 мл дважды в сутки до результата.

Корки граната от паразитов

Паразитов, остриц, глистов выводят настоем из кожуры граната.

Понадобится 50 г порошка из сухих или свежих корок. Его заливают 380-420 мл воды (примерно два стакана) комнатной температуры, прикрывают крышкой. Через 6-7 часов кипятят, пока количество жидкости не уменьшится наполовину. Остывшую жидкость фильтруют.

Начинают прием настоя гранатовых корок с утра, натощак. Его нужно выпить за час, разделив на 5-6 приемов. Через 30-40 минут принимают слабительное средство.

При ожогах

Эффективное средство лечения ожогов – измельченная до порошка гранатовая кожура и разбавленный гранатовый сок (5 частей воды на 1 часть сока). Жидкостью промывают ожог или ссадину, щедро присыпают порошком, накладывают марлевую повязку. Марля и порошок создадут корку-щит, под которой ожог заживет безопаснее и быстрее.
Подойдет и спиртовая настойка из гранатовых шкурок.

Косметология

Гранатовые корочки используют, чтобы быть красивыми и ухоженными. Популярные варианты из косметологии:

  1. Крем для лица. Обычное средство кремообразной текстуры по уходу за кожей или косметическое масло обогащается порошком из корок граната (45-55 г). Аппликации с гранатовым порошком разглаживают морщинки.
  2. Отвар-ополаскиватель для волос. 150 г корок граната заливают 450 мл воды, на слабом огне доводят до кипения (но не кипятят). Настаивают сутки. Применяют после мытья головы на влажные волосы. Средство укрепляет волосы, ускоряет их рост, но делает темнее.
  3. Настойка против перхоти. В раствор (как для отвара-ополаскивателя) добавляют 75 мл водки или разбавленного до водочной концентрации спирта. Настойку из корок граната и водки наносят на кожу головы или волосы максимум на 14-16 минут.

Гранатово-спиртовой состав противопоказан при чувствительной коже головы, пересушенных, ломких, посеченных волосах.

Для создания домашнего гранатового ассортимента в магазинные кремы или маски для лица можно добавлять витаминно-минеральные комплексы, масла, другие компоненты, используемые повседневно. Как пример, гранатовый порошок, прожаренный на оливковом масле. Средство хорошо помогает от высыпаний и прыщеватости.

Корки граната противопоказания и вред

Как любой продукт, тем более экзот, гранат, его кожура, другие компоненты имеют противопоказания.

Кому запрещен экзот

Шкурки граната запрещено использовать в следующих случаях:

  • индивидуальная непереносимость, аллергия на гранат;
  • предрасположенность к запорам, травмы прямой кишки, геморрой;
  • заболевания почек;
  • гепатит;
  • повышенный риск кровотечений.

Кожура граната несовместима с антигистаминными средствами, их параллельный прием опасен.

Что учитывать при использовании сырья

В кожуре граната сосредоточены токсичные элементы, провоцирующие отравление. Чтобы избежать этого, при применении гранатовых корок или продуктов из них соблюдают рецептуру и частоту приема. Маленьким детям при поносе дают чайную ложечку гранатового отвара (максимум пять раз за день), школьникам до 12 лет – столовую.

Во время беременности и при грудном вскармливании кожура граната как лечебное или профилактическое средство применяется только после консультаций с врачом.

Если это невозможно, отказ однозначен. Иначе проблемы возникнут не только у мамы, но и у ребенка.

Признаки отравления кожурой

Опасный компонент корок граната – органические щелочи (алкалоиды). Их чрезмерное количество вызывает тошноту, рвоту, общее недомогание, головную боль, головокружение, судороги, потемнение в глазах.

При появлении любого из этих симптомов прием гранатовых препаратов прекращают. В тяжелых случаях немедленно обращаются к врачу.

Заключение

Корки граната задействуют для красоты и более приземленных, практичных целей по сохранению здоровья. Их не стоит выбрасывать, ведь процесс заготовки несложен.

При соблюдении дозировки и меры пагубные побочные эффекты исключены, а позитивные изменения не заставят себя ждать.

Оцените статью:

Поделитесь с друзьями!

полезные свойства, терапия и способы приготовления

Еще с давних времен принято считать гранат королем всех фруктов и плодов. Это поверье берет свое начало на далеком Востоке. Но и у нас гранат является не менее важной и любимой культурой. И это неудивительно, среди остальных фруктов он очень выделяется благодаря своему огненному красному цвету. Его плоды довольно вкусные и обладают полезными свойствами. Однако, как оказалось, не только сочная мякоть, но и кожура этого фрукта имеет большое количество лекарственных и чудодейственных особенностей.

В каких случаях эффективна кожура граната?

Как правило, корки граната, полезные свойства которых известны многим не понаслышке, издавна активно используются в медицине. Они подавляют развитие вредных микробов в организме и являются отличным противовоспалительным средством. Корки граната также вполне можно добавлять в чай, так как такой напиток прекрасно успокаивает нервную систему.

Помимо этого, их можно использовать и при колите, малярии и многочисленных простудных заболеваниях. Но главный эффект при использовании этих волшебных гранатовых корочек связан с лечением такого неприятного недуга, как понос. В кожуре этого плода находится полифенил, поэтому она способствует быстрому подавлению кишечных и дизентерийных палочек.

Кроме того, в народе принято считать, что если есть в организме глисты, эффективную помощь могут оказать именно корки граната, лечение которыми заключается в приготовлении различных отваров. Полезные их свойства известны всему миру. Однако при их применении и лечении не стоит забывать и об осторожности, так как вместе со всеми лекарственными и противовоспалительными особенностями кожура граната обладает еще и рядом токсичных веществ.

Приготовление и сушка лекарства от поноса из гранатовых корок

Целесообразно корки граната, свойства которых имеют целебные качества, заготавливать заранее, так как в настоящее время приобрести, скажем, на рынке столь экзотическое лекарственное средство весьма проблематично. Для этого нужно аккуратно снять корочки с тщательно вымытого и высушенного полотенцем фрукта, при этом мякоть срезается максимально. Самые полезные вещества при борьбе с кишечными расстройствами находятся именно в верхних слоях гранатов.

После удаления мякоти оставшиеся корочки следует мелко измельчить и высушивать примерно одну неделю. Все это нужно положить на салфетку и сверху накрыть марлевой повязкой. При этом их нужно три раза в день перемешивать, так как при малейшей влажности такое сырье сразу начинает портиться. Уже высушенные корочки следует хранить в бумажных пакетах в прохладных сухих местах.

В том случае, когда нужно избавиться от поноса незамедлительно, то корки граната, полезные свойства которых были описаны выше, очень мелко измельчаются и завариваются одним стаканом кипятка. Эффективнее всего заварить одну чайную ложку измельченного сырья, поставить на водяную баню примерно на десять минут, а потом настаивать до часа.

Период действия средства от диареи из корок граната

Как правило, если соблюдены правильные пропорции, то такой заваренный настой можно выпить один раз и забыть про понос. Однако в некоторых случаях возможен и повторный прием этого лекарства спустя три часа. Кроме того, при запущенных случаях (сальмонеллез или другая болезнь) следует принимать подобный настой на протяжении трех дней по нескольку раза в день по половине стакана.

Как видно, в таких ситуациях довольно эффективны корки граната, польза от которых видна практически сразу. Ведь действуют они достаточно быстрым образом, а также проверены множеством людей. Тем более что каждый человек может себе позволить подобное лекарство, так как оно довольно выгодно по своей стоимости. Абсолютно нет надобности есть гранаты килограммами. Двух или трех штук, а точнее кожуры с них, достаточно.

Противопоказания к применению настоя

Обычно противопоказаний лекарство не имеет. Но злоупотреблять таким средством, как корки граната, польза от которых бывает очень большой, не стоит. Кроме того, необходимо соблюдать определенные пропорции, в зависимости от возраста и степени недуга. К примеру, если понос случается у детей, то также допускается применение гранатовых корок, но важна доза. Малыши, как правило, могут принимать по одной чайной ложке жидкого настоя пять раз в день, дети дошкольного возраста и младшие школьники — по столовой ложке так же, а подросткам (старше двенадцати лет) уже вполне можно давать взрослые пропорции.

Такое лекарственное сырье лучше заготавливать в осеннее время года ежегодно, а хранить на протяжении нескольких лет вовсе не рекомендуется, так как возникает риск получения какой-либо непредсказуемой реакции, что очень часто наблюдается у людей, имеющих склонность к кровотечениям. Кроме того, очень осторожно должны относиться аллергики к такому продукту, как корки граната. Отзывы же об этом лекарстве, несмотря на все вышеперечисленные ограничения, самые положительные.

Также нужно заметить, что плоды граната совсем не рекомендуется принимать тем людям, у которых наблюдаются хронические запоры, геморрой, а еще трещины в заднем проходе.

Целебные свойства граната и антимикробное действие его кожуры

Если говорить о количестве целебных свойств «короля плодов», то их довольно много. Многим известно, что сок граната содержит железо, поэтому он очень целебный. Употребление его в пищу способствует значительному повышению уровня гемоглобина в крови. При этом свежие гранаты тоже рекомендуют использовать при хроническом кашле, простуде и даже лихорадке.

Гранат и его кожура очень полезны в процессе выздоровления после инфекции, а совсем недавно выяснили, что корки от граната можно применять в профилактике сердечно-сосудистых и онкологических заболеваний.

Корки граната, лечение которыми чудодейственно сказывается на организме человека, а также сок этого фрукта в народной медицине активно применяются при различных болезнях почек. Кислые плоды очень эффективны в качестве средства для борьбы с камнями в почках и желчном пузыре. При этом сок гранатов замечательно утоляет жажду при лихорадке, а также имеет жаропонижающее действие.

Кожура гранатов используется при лечении болезней желудочно-кишечного тракта. Как говорилось ранее, она служит прекрасным вяжущим средством при поносах и дизентерии, а также при изгнании глистов. Кроме того, сухие корки граната могут спасти от тяжести в животе, хорошо лечат ангину, а также помогают от потливости ног.

Рецепт отвара от диареи

Всем известно, что при лечении диареи и других болезней желудочно-кишечного тракта необходимо пить отвар из гранатовых корочек. Чтобы его приготовить, потребуется пройти следующие этапы.

  • Шаг 1. Подготовить эмалированную кастрюлю, в которую поместить корки граната. Полезные свойства кожуры сохраняются при правильном соблюдении всех этапов приготовления настоя. Поэтому важно не передержать кастрюлю на огне.
  • Шаг 2. Залить содержимое холодной водой и поставить на плиту. Нагревать примерно полчаса.
  • Шаг 3. Полученную жидкость процедить.

Принимать такие растворы следует теплыми по половине стакана. Количество приемов — три раза в день, но при этом не злоупотреблять. Нужно помнить, что в случае превышения допустимой дозы при поносе возможен риск возникновения желудочно-кишечного кровотечения, поэтому так важно соблюдать все меры предосторожности. Бывают случаи, когда при передозировке появлялась слабость, рвота и головокружение.

Лечение заболеваний с помощью кожуры граната

Водный настой корок граната эффективно подавляет различные болезнетворные бактерии, присутствующие в желудочно-кишечном тракте. Такую методику разработал Глубокий Г. И. В принципе, в этой идее мало нового, ведь еще всем известный Гиппократ вылечивал различные раны и дизентерию у пациентов. Создатель этой методики вылечил всю свою семью, попавшую под эпидемию холеры за пять часов. А доктора, которые ознакомились с подобным методом лечения, справлялись за два дня.

Таким образом, стало известно, что с помощью корки граната лечение многих заболеваний может осуществляться за довольно короткие сроки. Так, излечивается дисбактериоз, колит, дизентерия, сальмонеллез, язва желудка, язва кишечника, холера, брюшной тиф и острый аппендицит. Причем процесс изготовления водного настоя, рецепт которого был описан выше, для всех этих болезней примерно одинаковый, а вот применение и дозировка отличаются.

Дозировка настоя из корок граната при разных заболеваниях

При лечении дисбактериоза, колита, язвы желудка и язвы кишечника настой сухой кожуры граната применяется таким образом: четыре раза равными порциями через одинаковые промежутки времени. Причем первый раз нужно выпить раствор на голодный желудок, сразу же после сна, а четвертый – непосредственно перед сном. Принимать такое лекарство следует через день, а в другие дни недели отдыхать.

При лечении противопоказано употреблять спиртные напитки. При всех вышеперечисленных заболеваниях пациенты должны четко знать, как заваривать корки граната. Для того чтобы закрепить результат, к примеру, в процессе лечения язвы, можно пройти повторно курс, но не раньше чем через одну неделю.

Кожура граната – проверенное средство

Как видно, многие заболевания можно вылечить с помощью такого простого продукта, как корки граната. Полезные свойства этого незатейливого плода известны всему миру. Настой из сухой кожуры этого фрукта подавляет болезнетворные бактерии во всем желудочно-кишечном тракте, при этом он не затрагивает необходимые полезные бактерии.

Таким образом, насладившись соком и вкусом сочного красного сладкого граната, не нужно выбрасывать корки граната. Свойства их вам пригодятся. А многие люди наверняка знают, что это верное, надежное и проверенное средство при борьбе с многочисленными недугами.

полезные и лечебные свойства, противопоказания к применению кожуры, как заваривать от кишечной инфекции

В давние времена на Востоке гранат называли не иначе как королем фруктов. С этим невольно соглашаешься, вспоминая благородный рубиновый оттенок мякоти и несравненный вкус. Немаловажно, что фрукт имеет множество целебных свойств, которые распространяются также на его косточки и кожуру. О пользе последней и пойдет речь.

Состав

Не только плод, но и кожура граната обладают целебными свойствами. Это обусловлено их составом.

  • Кожура плода содержит пищевые волокна, а также органические кислоты. Количество последних в корках меньше, чем в соке или мякоти, однако содержание их все равно достаточно велико.
  • Жиры, углеводы и белки. Вторые занимают основную часть и представлены фруктозой и глюкозой. Также в кожуре имеются зола и вода.
  • Чрезвычайно многообразен состав микро- и макроэлементов шкурки граната. Здесь содержится рекордное количество калия, а также магний, фосфор, железо, йод, кальций, цинк, медь и т. д. В ней можно обнаружить нечасто встречающийся во фруктах селен, никель и холин.
  • Но и на этом список полезных компонентов кожицы не заканчивается. В ней присутствуют витамины А, Е, К, РР, витамины группы В, а также провитамин бета-каротин и аминокислоты.

Высокое содержание углеводов обеспечивает калорийность кожуры в пределах 72-83 ккал на каждые 100 г продукта.

Полезные и лечебные свойства

Целебные свойства мякоти и кожуры граната известны еще с древнейших времен, а сегодня плод и его составляющие являются сырьем для некоторых фармацевтических препаратов, а также используются в народной медицине.

  • Кожура демонстрирует антиоксидантное действие – связывает радионуклиды, выводит токсины, позволяет нейтрализовать токсическое воздействие негативных факторов, замедляет процессы старения.
  • Благодаря присутствию этих же антиоксидантов и витамина К кожица граната (аналогичное действие демонстрирует кора гранатового дерева) оказывается способной улучшать состояние сосудистой системы. Повышается эластичность сосудов, снижается уровень «плохого» холестерина. Витамин К участвует в кроветворении, повышая вязкость крови, препятствуя развитию обильных кровотечений.
  • Железо, также имеющееся в составе, обогащает кровь кислородом, снижает риск развития анемии.
  • Гранат способен останавливать и снижать кровотечения, в том числе внутренние. Это делает его надежным природным помощником женщин, страдающих от обильных и болезненных менструаций.
  • Наличие калия и магния в кожуре также позволяет говорить о возможности укрепления сердца с помощью нее. Настой на основе корок рекомендован при тахикардии (учащенном сердцебиении), ишемии, в качестве профилактики, а также на этапе восстановления после перенесенных инфарктов и инсультов.
  • Кожура помогает при расстройствах желудка, диарее, поскольку крепит, оказывает вяжущее действие. Кроме того, благодаря многообразию жизненно важных для организма химических элементов, кожица спасает от вымывания минералов, неизбежно происходящего при диарее.
  • Помогает средство при дизентерии, дисбактериозе, нарушениях стула вследствие непереваривания пищи. Кожица является также противогельминтным средством. Она особенно эффективна для выведения таких паразитов, как глисты.
  • Обладающими противовирусными и антибактериальными свойствами шкурками лечат болезни дыхательных путей. Они облегчают состояние и ускоряют выздоровление при ринитах, астме, бронхитах и даже туберкулезе. Будучи антисептиком, отвар на основе гранатовой кожуры поможет при заболевании слизистых ротовой полости (стоматиты, гингивиты, воспаления после лечения и санации полости рта).
  • А благодаря своим противоожоговым, обеззараживающим и ранозаживляющим характеристикам они могут использоваться наружно для заживления ран, снятия воспалений кожных покровов и слизистых, лечения ожогов.

Почему помогает при кишечных инфекциях?

Польза гранатовых корок для органов ЖКТ обусловлена присутствием в составе дубильных веществ. Демонстрируя вяжущее свойство, они помогают остановить диарею, помочь при спазмах в животе, коликах. Среди дубильных веществ (полифенольных соединений) следует отдельно выделить катехины и танин, которые эффективны даже при дизентерии. Благодаря способности водного настоя на гранатовых корках подавлять болезнетворные бактерии, вызывающие кишечные инфекции, с его помощью удается в короткие сроки вылечить пациента от сальмонеллеза, дисбактериоза, дизентерии, колитов, «кишечного гриппа», брюшного тифа, холеры.

Немаловажно, что гранатовые корки демонстрируют эффективность уже после первого применения.

При несильной диарее неинфекционного генеза часто достаточно однократного приема настоя. Иногда процедуру приходится повторять еще 2-3 раза через каждые 3-5 часов. При серьезных нарушениях, дизентерии и кишечных инфекциях требуется пропить настой курсом.

Вред

Противопоказания к применению гранатовой кожицы сводятся в первую очередь к наличию аллергии на его плоды.

Важный момент – в кожуре, помимо целебных компонентов, присутствуют алкалоиды. При чрезмерном поступлении их в организм возможна передозировка. Ее проявлением станут тошнота, головные боли, рвота, судороги и даже потеря сознания. В связи с этим важно соблюдать дозировку и не злоупотреблять настоем. Не рекомендовано давать его детям младше 5-6 лет, принимать в период беременности и лактации.

Из-за способности корок влиять на процессы кроветворения, их прием может быть не рекомендован при заболеваниях крови, в первую очередь повышенной ее вязкости. Лучше не сочетать употребление настоя с лечением антикоагулянтами.

Склонность к запорам и наличие геморроя и анальных трещин также являются причиной отказа от лечения гранатовыми корками, поскольку прием последних лишь усугубит ситуацию.

Не стоит принимать состав при патологии почек (в первую очередь нефритах, почечной недостаточности), гепатитах, новообразованиях различного генеза и характера.

Как применять?

Прежде чем использовать кожуру граната, необходимо подготовить ее. Сначала нужно тщательно помыть плод, чтобы удалить воск и возможные химические составы, которые обычно наносят на фрукты во время транспортировки.

После этого гранат нужно почистить, мякоть съесть, а получившуюся кожицу освободить от белых прожилок. Они не нужны. Далее кожура измельчается – метод и размеры частиц зависят от особенностей рецепта. Можно просто нарезать кожицу неширокими полосками, а также натереть как цедру на терке или перетереть в кофемолке.

Полученная субстанция содержит воду, что приводит к ее заплесневению в процессе хранения. Испарить жидкость поможет сушка. Для этого на ровной поверхности выкладывают гранатную кожуру и сушат ее в хорошо освещенном, но прохладном месте. Можно сделать это в духовке при температуре не выше +50-70°C. Лучше немного приоткрыть дверцу духовки, чтобы влага испарялась скорее.

Когда кожура окончательно просохнет, ее перекладывают в герметично закрывающуюся тару или пакеты с застежкой. Срок ее годности – 12 месяцев.

Для заготовки сырья следует использовать спелый плод. Он имеет темно-бордовую сухую кожицу, допустимо наличие более темных пятен. А вот светлую или желтую корку использовать не следует, она не принесет пользы.

Способы употребления правильнее условно разделить на 2 вида – однократный прием и длительный курс. Первый обычно требуется, чтобы устранить последствия несильной диареи неинфекционной природы. При более длительном приеме первую порцию настоя следует выпивать утром натощак. После последнего вечернего приема не следует употреблять пищу.

При склонности к поносу можно жевать сухие корки. Безопасная дозировка для взрослого – 3 г в сутки. Применять их следует после еды. Можно разбить норму на несколько приемов или съедать продукт за один раз.Детям вряд ли понравится жевать сухие корочки.

Лучше заменить этот вариант приемом стакана гранатового сока, разведенного напополам с водой.

Рецепты

Особенности применения гранатовой кожуры зависят от характера недуга. Рассмотрим наиболее известные своей эффективностью рецепты. Важный момент – из-за содержания токсичных компонентов следует соблюдать точные пропорции корок и воды. Это соотношение должно быть в пределах 1: 20.

Большинство рецептов предполагает длительное настаивание состава. Однако оно не должно превышать 12 часов. Обычно залитые кипятком корки накрывают блюдцем или крышкой и оставляют при комнатных условиях до тех пор, пока температура настоя не позволит быстро выпить его. 3-4 часов, как правило, достаточно для этого.

При расстройствах ЖКТ, диарее

При проблемах с органами ЖКТ, в том числе диарее, интоксикации кишечника, следует залить половиной стакана горячей воды 5 мг высушенных корок. Смесь настоять на протяжении нескольких часов и в остывшем виде предложить больному.

Настой принимают 3 раза в день (дозировка для взрослых). Детям старше 12 лет достаточно двукратного приема. Если ребенку меньше 12 лет, то достаточно один раз выпить состав, при этом лучше уменьшить его объем – заваривать 1.5 -2 г сырья 30-40 мл воды.

Еще один рецепт, который поможет устранить неприятные симптомы расстройства желудка, диарею. Для этого 12 г сырья заливают стаканом воды. Настаивают часа 2-3, а после выпивают в непроцеженном виде по полстакана.

Как правило, при несварении желудка достаточно однократного приема. При проблемах, вызванных инфекцией, требуется несколько сеансов. В таком случае пить настой следует каждые 3-5 часов до улучшения состояния.

При серьезных расстройствах можно пить его в течение 7 дней, а затем устроить недельный перерыв и повторить курс.

Против гельминтоза

Для борьбы с гельминтами гранатовые корки в количестве 1 столовой ложки заливаются стаканом воды, после чего также настаиваются в течение нескольких часов и выпиваются в теплом виде. Дозировка аналогична той, что указана в предыдущем рецепте. То есть взрослый принимает состав 3 раза в сутки, ребенок старше 12 лет – 2 раза, младше 12 лет – один раз.

Еще один рецепт предполагает следующий вариант приготовления отвара: 50 г гранатового порошка следует залить половиной литра горячей воды и настаивать 5-6 часов. Затем смесь ставят на огонь и доводят до кипения. Остужают и принимают с утра натощак вместе со слабительным.

Противовоспалительный состав

Данный вариант настоя характеризуется мощным противовоспалительным действием, поэтому имеет универсальное назначение. Он может применяться при инфекционных заболеваниях кишечника, а также в качестве полоскания при болях в горле, воспалениях в полости рта.

Для его приготовления следует взять 2 чайные ложки сухого сырья и залить их стаканом кипятка. Поместить тару с составом на водяную баню и томить полчаса. Процедить и принимать полученный концентрат по 500 мл дважды в сутки перед приемом пищи. Длительность лечения – до полного выздоровления, но не более недели.

Иммуноукрепляющий состав

Витаминно-минеральное богатство продукта позволяет использовать его в качестве укрепляющего и восстанавливающего иммунитет напитка. А повысить его эффективность помогут не менее полезные «компаньоны» – мята, имбирь.

Для приготовления укрепляющего чая следует смешать чайную ложку сушеного имбиря, 1 столовую ложку гранатового сырья и 3-4 листочка мяты. Заварить их 300-400 мл горячей воды и настаивать 5-7 минут. После этого, когда состав немного остынет, положить 4-5 долек лимона и столовую ложку меда, тщательно перемешать.

Пить чай достаточно раз в сутки на протяжении месяца, затем сделать перерыв в 7-10 дней.

При ожогах

Настой из гранатовых корок при ожогах используется как наружное средство. Для этого чайную ложку сырья заливают половиной стакана кипятка, настаивают и остужают.

После этого нужно смочить в составе ватный диск и протереть им пораженную кожу. Можно оставлять его на месте ожога на 2-3 минуты. Частота процедуры – до 5 раз за день.

Рекомендации

Настой на основе гранатовых корок нашел применение не только в народной медицине, но и в косметологии. На его основе можно готовить маски и лосьоны, которые особенно эффективны в борьбе с повышенной сальностью кожи лица, тела, головы. Кроме того, содержащий антиоксиданты настой может оказаться действенным средством в борьбе с первыми проявлениями возрастных изменений кожи – снижением тонуса.

Отзывы говорят, что данный состав позволяет избавиться от шелушения кожи головы, ускорить рост волос. Настой может заменять воду и прочие жидкие компоненты, которые предполагает рецепт маски. Самый простой способ – развести на нем косметическую глину. Получившуюся кашицу следует перемешать и наложить на лицо на 15-20 минут.

Подробнее о пользе и свойствах корок граната вы узнаете из следующего видео.

Гранат — вкусная польза от зёрнышка до корки

Оксана Смелая

Этот плод с древних времён считался символом здоровья и благополучия, и, как утверждают учёные, не зря

Кому и для чего есть гранат

Пользу организму гранат приносит большую. Корочки используются для различных лекарственных отваров. Например, настой из них можно принимать при сильном расстройстве кишечника. Но, как всегда, с осторожностью — это сильное средство!

Гранатовые зерна содержат кальций, магний, калий, марганец, фосфор, йод, железо, натрий.

Сок граната насыщен растительными кислотами: лимонной, яблочной, винной, щавелевой, янтарной. Благодаря им этот плод возбуждает аппетит и помогает пищеварению при пониженной кислотности желудка.

Гранатовый сок содержит много кислот: лимонной, яблочной, винной, щавелевой, янтарной Фото: 123ru.net

Полезен гранат и тем, кто страдает болезнями сердечно-сосудистой системы. Он укрепляет сосуды, нормализует артериальное давление, способствует кроветворению, активному синтезу гемоглобина и эритроцитов. Поэтому гранатовый сок часто назначают при анемиях, пониженном гемоглобине и общей слабости в восстановительный период после болезней и операций. Полезен всем пожилым людям как профилактика заболеваний сердца и сосудов.

Секреты древних лекарей

Современные врачи признают полезные свойства граната, которые были открыты народной медициной.

Белые перемычки, которые находятся внутри плода, сушат и добавляют в горячие растительные настои. Полезно для укрепления нервов и от бессонницы.  

Настои из корочек граната помогают при сильной диарее. Только помните, что принимать их без назначения врача нельзя! Фото: dary-prirody.su

Гранат способствует омоложению и в качестве профилактики онкологии, а также его следует есть тем, кто был в условиях повышенной радиации.

Гранатовый сок – эффективная профилактика цинги и ОРВИ, так как содержит витамин С в высокой  концентрации.

Прекрасная добавка к любому блюду

В основном мы привыкли есть только зерна  граната. Но также используют и гранатовый сок для приготовления жареных, тушеных и вареных блюд, варенья и пастилы. Гранат универсален, и прекрасно сочетается и с мясом, и со сладкими фруктами.

Гранатовые зерна и сок широко используются в кулинарии, особенно в кавказской кухне Фото: www.koolinar.ru

Особенно большую роль гранат играет в  кавказской кухне. Из него делают соусы, да и просто добавляют горстями к овощам и мясу. Вот один из рецептов вкусного салата. Вам понадобятся: гранатовые зерна – горсть, пекинская капуста – 2-3 листа, половина небольшой куринй грудки, одно вареное яйцо, несколько веточек петрушки, оливковое масло, лимонный сок – по 1 ст.л, перец черный молотый, соль – по вкусу.

Отварить в подсоленной воде куриную грудку без кожи. Сварить куриное яйцо. Остудить и нарезать кубиками. Нашинковать капусту и зелень. В миске смешать масло, перец, соль, сок лимона. Соединить все ингредиенты в салатнике, заправить и перемешать.

Пара советов

Выбирая гранат, стоит обратить внимание на кожуру. У спелого плода корочка чуть подсохшая, твердая и местами повторяет форму зерен внутри. Если же кожура гладкая и лепестки плода зеленые – гранат неспелый. Спелый гранат обычно крупный и тяжелый.

Гранаты – одни из самых подходящих для длительного хранения плодов. Они могут пролежать и 10, и 12 месяцев. Наиболее спелые плоды продаются в ноябре.

Кстати, гранат можно заморозить, целым или только зерна. При этом полезные свойства практически не теряются.

продукты

Преимущества гранатовой кожуры

Гранаты известны своим вкусом и удивительной пользой для здоровья.

Однако очень немногие знают о преимуществах его кожи, которую мы выбрасываем.

Кожура, как и фрукт, имеет много преимуществ.

Благодаря своим лечебным свойствам кожура граната может эффективно бороться с угрями, прыщами и сыпью.

Кожура богата антиоксидантами и помогает избавиться от бактерий и других инфекций.

Можно взять две ложки сушеной на солнце и порошковой цедры и добавить к ней немного молока.

Если у кого-то жирная кожа, можно вместо молока добавить в порошок розовую воду и сделать из него пасту.

Нанесите эту пасту на лицо и держите, пока она не высохнет.

Вымойте лицо теплой водой и попробуйте использовать порошок не реже двух раз в неделю для достижения лучших результатов.

Гранатовый пилинг также увлажняет и защищает кожу от загрязняющих веществ и других токсинов окружающей среды.

Восстанавливает pH-баланс кожи.

Эллаговая кислота, содержащаяся в пилингах, удерживает влагу в коже, делая ее мягкой и эластичной.

Вяленую кожуру граната измельчить в миксере и высыпать порошок в чистую миску.

Приготовьте порошка, которого хватит на неделю, и храните в герметичном контейнере.

Возьмите две ложки порошка и хорошо смешайте с йогуртом, чтобы получилась паста.

Нанесите эту пасту на лицо и шею и оставьте на 10 минут.

Далее смойте холодной водой.

Возьмите две ложки сушеного на солнце порошка граната и добавьте к нему одну ложку коричневого сахара.

Чтобы приготовить пасту, добавьте одну ложку меда, одну ложку масла авокадо или любое эфирное масло по выбору и хорошо перемешайте.

Затем потрите лицо домашним скрабом и тщательно помассируйте.

Смыть водой, чтобы кожа стала гладкой и эластичной.

Однако после очистки важно использовать тоник и увлажняющий крем.

Сделайте порошок из высушенной на солнце кожуры граната и храните в герметичном контейнере.

Смешайте этот порошок с любым лосьоном или кремом, желательно за 20 минут до выхода из дома.

В качестве альтернативы можно также смешать пудру с некоторыми эфирными маслами и нанести на лицо, если вы хотите использовать натуральный солнцезащитный крем.

Положительное влияние экстракта кожуры граната и пробиотиков на дифференцировку преадипоцитов

Front Microbiol.2019; 10: 660.

Валерия Сорренти

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Catania, Italy

Cinzia Lucia Randazzo

2 Dipartimento di Agricolté di Agricolt Università di Catania, Катания, Италия

Cinzia Caggia

2 Dipartimento di Agricoltura, Alimentazione e Ambiente — Di3A, Università di Catania, Катания, Италия

Gabriele Ballistreri

3 Gabriele Ballistreri

) — Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Флора Валерия Ромео

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Симона Фаброни

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр оливок и цитрусовых and Tree Fruit, Ачиреале, Италия

Николина Тимпанаро

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр оливковых, цитрусовых и древесных фруктов, Ачиреале, Италия

Марко Раффаэле

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Catania, Italy

Luca Vanella

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

1 Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

2 Dipartimento di Agricoltura, Alimentazione e Ambiente — Di3A, Università di Catania, Катания, Италия

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Под редакцией: Розальба Ланчотти, Болонский университет, Италия 90 003

Рецензент: Анна Реале, Институт науки и технологий (ISA), Италия; Коши Филип, Малайский университет, Малайзия

Эта статья была отправлена ​​в раздел «Пищевая микробиология» журнала «Границы микробиологии»

Поступила в редакцию 22 октября 2018 г .; Принята в печать 15 марта 2019 г.

Авторские права © 2019 Сорренти, Рандаццо, Каджия, Баллистрери, Ромео, Фаброни, Тимпанаро, Раффаэле и Ванелла.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (CC BY). Использование, распространение или воспроизведение на других форумах разрешено при условии указания автора (авторов) и правообладателя (ов) и ссылки на оригинальную публикацию в этом журнале в соответствии с принятой академической практикой. Запрещается использование, распространение или воспроизведение без соблюдения этих условий.

Эта статья цитируется в других статьях в PMC.

Abstract

Благоприятные эффекты граната обусловлены содержанием эллагитаннинов и антоцианов, которые защищают от множества заболеваний, включая воспалительные. Многие исследователи сообщают, что экстракты отходов граната (кожуры и семян), полученные из отходов промышленной переработки, обладают акцептором свободных радикалов и обладают мощной антиоксидантной способностью. Сообщалось также, что экстракты граната (ПЭ) обладают антибактериальной, противовирусной, гиполипидемической и противовоспалительной биоактивностью благодаря содержанию полифенольных соединений, которые включают пуникалагины, галловую кислоту и производные эллаговой кислоты.В центре внимания данной рукописи было изучение пребиотического потенциала PE, растворимого в воде и охарактеризованного с помощью HPLC – PDA – ESI / MS n на предмет его фенольного содержания. Более того, поскольку сообщалось, что экстракты граната снижали уровень липидов в крови и что было показано, что ряд пробиотических штаммов влияет на адипогенез в культуре клеток, это исследование также было проведено для проверки in vitro эффектов PE и пробиотик л.rhamnosus GG ATCC 53103 (LGG) на линии клеток 3T3-L1. ПЭ и пробиотики существенно снижали содержание триглицеридов и увеличение внутриклеточных липидов по сравнению с контрольной группой. Однако комбинированная обработка отработанного бульона (SB), отфильтрованного через PE и LGG, была наиболее эффективной для снижения содержания триглицеридов и накопления внутриклеточных липидов. Уровни экспрессии мРНК основных транскрипционных факторов, участвующих в дифференцировке адипоцитов, были существенно ниже в клетках 3T3-L1, обработанных PE и SB, отфильтрованных через LGG.Эти результаты свидетельствуют о том, что синергетический эффект пробиотиков и полифенолов, содержащихся в PE, может влиять на адипогенез in vitro, и может способствовать разработке новых нутрицевтических / пробиотических средств для профилактики и лечения ожирения.

Ключевые слова: лактобациллы, антимикробная активность, экстракт граната, дифференциация адипоцитов, комбинирование продуктов

Введение

Гранат — это фрукт, положительное влияние на здоровье которого было тщательно изучено.Этот фрукт богат биологически активными соединениями, такими как эллагитаннины и антоцианы, которые защищают от дегенеративных заболеваний. Плод граната из-за его высокой питательной ценности, пользы для здоровья и биоактивных антиоксидантных соединений считается пищевым лекарством. Фактически, гранат широко используется в фитотерапии при нескольких патологиях, включая грипп и инфекции верхних дыхательных путей. Все части плодов граната, то есть кожура и семена, рассматриваемые как отходы, могут быть переработаны для получения продуктов с добавленной стоимостью, имеющих промышленную, медицинскую и косметическую ценность (Dhumal et al., 2014).

Отходы граната образуются на всех этапах жизненного цикла плодов, то есть во время сельскохозяйственного производства, промышленного производства и переработки. Можно использовать побочные продукты граната, поскольку они являются богатым источником биологически активных соединений, таких как флавоноиды, фенольные кислоты и дубильные вещества. Более того, многие исследователи описали, что экстракты граната, полученные из побочных продуктов перерабатывающих заводов, обладают эффективным улавливанием свободных радикалов и антиоксидантной способностью (Lee et al., 2010; Panichayupakaranant et al., 2010; Fischer et al., 2011).

Кроме того, экстракты граната действуют как естественные ингибиторы патогенов, бактерий и грибков (Al-Zoreky, 2009; Tehranifar et al., 2011; Romeo et al., 2015).

Эллагитаннины граната гидролизуются микробиотой кишечника до более мелких фенольных соединений, таких как эллаговая кислота. Затем эллаговая кислота всасывается в кровоток, в то время как эллагитанины не всасываются и метаболизируются в уролитины.

Сообщалось, что побочные продукты граната и пуникалагины в значительной степени способны ингибировать рост патогенных Escherichia coli , Pseudomonas aeruginosa , Clostridia и Staphylococcus aureus et al (Reddy aureus et al., ., 2007; Bialonska et al., 2009) и для увеличения роста полезных бактерий, включая Bifidobacterium spp. и Lactobacillus spp. (Reddy et al., 2007; Bialonska et al., 2010).

Экстракты граната также снижают уровень липидов в крови и обладают значительной противоопухолевой, противовирусной и противовоспалительной активностью (Li et al., 2006; Hossin, 2009; Lin et al., 2013; Bassiri- Джахроми, 2018).

Эти потенциальные полезные эффекты приписываются полифенольным соединениям, которые содержатся в экстрактах граната, включая пуникалагины, галловую кислоту и производные эллаговой кислоты (Vanella et al., 2013а, б, в; Romeo et al., 2015).

Поскольку ожирение является одной из основных проблем общественного здравоохранения, необходимы новые превентивные стратегии (Smith and Smith, 2016).

Адипоциты играют важную роль в начале или развитии метаболических осложнений, связанных с ожирением, таких как метаболический синдром и диабетические осложнения (Kim and Plutzky, 2016).

Интерес исследователей к выявлению натуральных продуктов, полученных из диетических растений, обладающих активностью против ожирения, возрос.Сообщалось, что ксантиген и фукоксантин, природные соединения масла косточек граната, значительно подавляли дифференцировку адипоцитов и накопление липидов (Lai et al., 2012).

Настоящая рукопись посвящена прежде всего изучению антиоксидантной и антимикробной активности, а также пребиотического потенциала ПЭ, богатого фенольными соединениями. Более того, обогащенный стандартизованный полиэтилен, содержащий высокий процент природных антиоксидантов граната, был химически охарактеризован с помощью ВЭЖХ – PDA – ESI / MSn.Во-вторых, поскольку гранатовый сок (Les et al., 2018) и различные типы экстрактов граната (PE), включая экстракт, полученный из цельного фрукта (Li et al., 2015), и экстракт, полученный из кожуры граната (Neyrinck et al., 2013), и было показано, что ряд пробиотических штаммов (Moon et al., 2012; Park et al., 2014) влияют на адипогенез, это исследование было проведено для проверки in vitro эффектов PE, пробиотика L rhamnosus GG ATCC 53103 (LGG), предварительно инкубированные с PE, отдельно или в комбинации, при дифференцировке клеток 3T3-L1.

Материалы и методы

Химические вещества

Порошкообразный экстракт граната (Dermogranate ® ), использованный в этом исследовании, был предоставлен Medinutrex (Катания, Италия). Вкратце, экстракт готовили из сушеных и измельченных плодов граната, смешанных с водно-спиртовыми растворами (пищевой), а затем фильтровали. Фильтрат концентрировали и затем сушили распылением для получения стандартизованного экстракта. Экстракт Dermogranate ® имел следующий химический состав: общие полифенолы (16%), пуникалагины (8%), эллаговая кислота и производные (8%).

Реагент Фолина – Чокальтеу (FCR), карбонат натрия (Na 2 CO 3 ), галловая кислота, пуникалин (смесь аномеров), пуникалагин и эллаговая кислота были приобретены у Sigma-Aldrich (Милан, Италия). Гранатин Б был приобретен у LGC Standards (Лондон, Великобритания). Для хроматографии использовали растворители степени чистоты для ВЭЖХ – МС (Merck KgaA, Дармштадт, Германия), а все остальные реагенты были аналитической чистоты.

Определение общего содержания полифенолов

Анализ Folin – Ciocalteu (Singleton et al., 1999) был использован для определения общего содержания полифенолов с небольшими модификациями. 0,1 мг / мл экстракта растворяли в дистиллированной воде. Затем к 500 мкл образца добавляли 5 мл 10% FCR и 4,5 мл раствора Na 2 CO 3 (7,5% мас. / Об.). Конечный раствор перемешивали в течение 2 часов в темноте, а затем измеряли Abs при λ = 765 нм. Анализы проводили в трех экземплярах, и общую концентрацию полифенолов выражали в граммах эквивалентов галловой кислоты (GAE) / 100 г экстракта.

HPLC – PDA – ESI / MS

n Анализ фенольных соединений

Разделение и количественное определение фенольных соединений выполняли, как описано ранее (Romeo et al., 2015). Для идентификации фенольных соединений времена удерживания (RT), спектры и данные МС в режиме отрицательного ESI сравнивали с данными аутентичных стандартов. Количественное определение каждого фенольного соединения проводили с использованием соответствующего стандарта в качестве внешнего стандарта. Количественное определение галловой кислоты проводили при 280 нм.Пуникалины, гранатин В, пуникалагины и эллаговая кислота определялись количественно при 378 нм; та же длина волны использовалась для количественного определения производных эллаговой кислоты с использованием эллаговой кислоты в качестве стандарта сравнения. Анализы проводили в трех экземплярах, и результаты выражали в г соединения / 100 г экстракта.

Тушение DPPH

Способность улавливать свободные радикалы различных концентраций экстракта PE (3,4–1,7–0,85–0,56–0,42–0,34–0,21–0,17–0,11–0,085–0,028 мг / мл) измеряли по 2, Безрадикальный метод 2-дифенил-1-пикрилгидразилгидрата (DPPH), как сообщалось ранее (Salerno et al., 2012). Результаты выражены в процентах от скорости ингибирования ± SD .

Влияние поглотителя на супероксид-анион

Способность улавливать супероксид-анион различных концентраций экстракта ПЭ (3,4–1,7–0,85–0,56–0,42–0,34–0,21–0,17–0,11–0,085–0,028 мг / мл) определялась как сообщалось ранее (Салерно и др., 2012). Результаты выражаются в процентах от скорости ингибирования ± стандартное отклонение.

Мышиные преадипоциты 3T3-L1 Жизнеспособность клеток

Мышиные преадипоциты 3T3-L1 были приобретены в Американской коллекции типовых культур (Роквилл, Мэриленд, США).Клетки высевали в концентрации 2 × 10 5 клеток на лунку 96-луночного микропланшета и культивировали при 37 ° C в инкубаторе с 5% CO 2 в течение 48 часов в отсутствие и в присутствии различных концентраций ЧП сообщалось выше. Жизнеспособность клеток измеряли с помощью анализа МТТ, как сообщалось ранее (Di Giacomo et al., 2015). МТТ, желтый тетразол, в живых клетках восстанавливается до пурпурного формазана. Результаты выражены в процентах формазана, продуцированного в обработанных мышиных преадипоцитах 3T3-L1 по сравнению с необработанными клетками.

Микробиология

Бактериальное культивирование

Использовались коммерческие штаммы патогенов E. coli ATCC 25922, S. aureus ATCC 29213, Listeria innocua ATCC 33090 и Salmonella enterica28 ATCC 140138 ATCC. Штамм E. coli выращивали в бульоне Лурия-Бертани (LB) при 37 ° C в течение ночи; S. aureus , S. enterica и L. innocua обычно выращивали в течение ночи в триптон-соевом бульоне (TSB) при 37 и 30 ° C соответственно.Все материалы и приложения предоставлены Oxoid (Милан, Италия).

Коммерческие пробиотические штаммы LGG, Bifidobacterium animalis BB12, B. longum BB536 и дикий штамм Lactobacillus paracasei N 24, выделенный из кротонского сыра пекорино, культивировали в бульоне Демана – Рогоза – Шарпа (MRS). при 37 ° C в течение ночи.

Ночные бактериальные культуры инкубировали при 37 ° C в течение 24 часов в анаэробных условиях, пока они не достигли плотности клеток приблизительно 1.0 × 10 9 КОЕ / мл.

Определение скорости роста

На основании результатов, полученных по активности PE в качестве акцептора свободных радикалов, и экспериментов по жизнеспособности преадипоцитов мышей 3T3-L1, для обработки штаммов пробиотиков или патогенов, как описано ниже, использовали различные концентрации.

Антимикробная активность PE оценивалась против коммерческих штаммов патогенов, упомянутых выше. Ночные культуры патогенов совместно культивировали при 37 ° C в течение 24 ч с PE в различных концентрациях (1.7–0,34–0,17 мг / мл), а антимикробную активность оценивали путем подсчета живых бактерий на чашках и выражали в КОЕ / мл.

Влияние PE на рост пробиотических штаммов, упомянутых выше, оценивали при совместном культивировании пробиотических штаммов с плотностью клеток приблизительно 1,0 × 10 9 КОЕ / мл с PE в различных концентрациях (0,085–0,042– 0,028 мг / мл). Влияние экстракта на рост пробиотических штаммов оценивали после инкубации при 37 ° C в течение 24 часов в анаэробных условиях, подсчитывая количество живых бактерий и выражая в КОЕ / мл.

Все эксперименты проводились в двух экземплярах, а результаты выражались в виде средних значений и стандартного отклонения. Основываясь на предварительных результатах, для последующего анализа была выбрана LGG.

Свежие бульонные культуры центрифугировали при 5000 об / мин в течение 10 минут при 4 ° C, супернатант декантировали для сбора отработанного бульона (SB), который фильтровали (FSB) с использованием фильтра 0,22 мкм и затем использовали для дальнейшего использования. анализы.

Бактериальный осадок ресуспендировали в 1 мл PBS и пять раз обрабатывали ультразвуком с амплитудой 44% в течение 2 мин с 6 мин отдыха.Затем обработанный ультразвуком центрифугировали при 1100 × g в течение 15 минут при 4 ° C. Супернатант собирали, фильтровали через фильтр 0,22 мкм и меченный экстракт бактериальных клеток (CE). CE использовался для дальнейшего анализа.

Культура клеток и дифференцировка клеток адипоцитов

Преадипоциты мышей 3T3-L1 ресуспендировали в среде Игла, модифицированной Дульбекко (DMEM), содержащей 10% фетальной бычьей сыворотки (FBS, Invitrogen, Карлсбад, Калифорния, США) и 1% антибиотика. / антимикотический раствор (Invitrogen, Карлсбад, Калифорния, США) и высевали в колбу размером 75 см 2 при плотности от 1 до 2 × 10 4 клеток.Дифференцировку клеток адипоцитов получали, как сообщалось ранее (Waldman et al., 2016).

Дифференцирующие преадипоциты 3T3-L1 обрабатывали в течение 7 дней PE (0,028 мг / мл), LGG CE (25 мкг / мл) и SB, отфильтрованным через LGG (10 мкг / мл) из ночной бактериальной культуры, инкубированной с или без ПЭ (0,028 мг / мл).

Количественное определение содержания липидов

Для количественной оценки накопления липидов проводили масляное красное окрашивание, как сообщалось ранее (Barbagallo et al., 2017). Образование липидных капель измеряли с помощью инвертированного многоканального светодиодного флуоресцентного микроскопа (Evos, Life Technologies, Гранд-Айленд, Нью-Йорк, США).

Экстракция РНК и qRT-PCR

Экспрессии адипонектина, PPAR-γ, SREBP, FAS, IL-6 и IL-10 оценивали с помощью ПЦР в реальном времени. РНК экстрагировали и количественно оценивали, как сообщалось ранее (Raffaele et al., 2018). Использовали соответствующие последовательности праймеров (). Относительный уровень экспрессии мРНК измеряли по значению порогового цикла (Ct) каждого продукта ПЦР и нормализовали с таковым для GAPDH с использованием сравнительного метода 2 -ΔΔCt .

Таблица 1

ПЦР-праймеры, использованные в этом исследовании.

Gene Прямой праймер Обратный праймер
Адипонектин GAAGCCGCTTATGTGTATCGC GAATGGGTACATTGGGAACAGT
IL-6 TTCCTCTCTGCAAGAGACTTCC AGGAGAGCATTGGAAATTGGGG
FAS GGAGGTGGTGATAGCCGGTAT TGGGTAATCCATAGAGCCCAG
GAPDH AGCTTCGGCACATATTTCATCTG CGTTCACTCCCATGACAAACA
IL-10 GCTGGACAACATACTGCTAACC ATTTCCGATAAGGCTTGGCAA
SREBP-1 GATGTGCGAACTGGACACAG CATAGGGGGCGTCAAACAG
PPAR-γ TCGCTGATGCACTGCCTATG ACCTGATGGCATTGTGAGACAT

Статистический анализ

Статистический анализ множественных сравнений был выполнен e Метод Фишера. P — значения ниже 0,05 были приняты как значимые. Данные были проанализированы с использованием либо однофакторного дисперсионного анализа (ANOVA) для нескольких групп, либо непарного t -теста для двух групп, и результаты представлены как среднее ± стандартное отклонение.

Результаты

HPLC – PDA – ESI / MS

n Анализ PE

Фенольный профиль PE () включал определение 1 гидроксибензойной кислоты и 19 эллагитаннинов. Основные пики соответствовали пуникалину (пик 4), гранатину B (пик 6), пуникалагину A и B (пики 10 и 14) и эллаговой кислоте (пик 19) ().Выявлено также присутствие галловой кислоты (пик 1) и производных эллаговой кислоты (пики 2, 3, 5, 7–9, 11–13, 15–18, 20). Как показано на хроматограмме, эллагитаннины являются преобладающим классом фенольных соединений в кожуре и выжимках граната (побочный продукт, состоящий из семян и кожуры), поскольку они составляют более 99% от общего содержания фенольных соединений граната. Пуникалагины, основные эллагитаннины побочных продуктов граната, составляли 47,6% от общего содержания фенольных соединений в ПЭ (). Производные эллаговой кислоты, эллаговая кислота и другие второстепенные фенольные соединения (пуникалин, гранатин B и галловая кислота) составили 38.4, 10,2 и 3,8% от общего содержания фенолов в ПЭ соответственно ().

ВЭЖХ-хроматограмма фенольных соединений ПЭ, обнаруженных при 378 нм. Об идентификации пиков см.

Таблица 2

Список пиков и количественное определение фенольных соединений в ПЭ.

± 0,04

9

9045 9045 900 9030

9045 9045

,3605 9045 9045 16,8 Ead d

15455 4,77 ± 0,21

903 9045 900

,3605 9045 35,4 Ead d

9045 9045 9045

9030 7.82

3 903 903 9030 903 903 903 903 903 9030 903 903 9030

Номер пика a RT (мин) λ (нм) [M – H] ( м / z ) MS n ( м / z ) Фенольные соединения г / 100 г b
1 3.9 269,310 169 125 Кислота галловая 0,07 ± 0,02
2 4,1 255,364 301 903

9045 9045 301 903 903 903 905 905 303 903 903 905 905 303 903 900

3 7,0 255,363 301 Ead d 0,41 ± 0,04
4 7,3 263,364 903 309

263,364 903 309

5 8,4 264,366 301 Ead d 0,19 ± 0,09
6 9,5

6 9,5 903 Гранатин B 0,28 ± 0,03
7 10,4 259,361 301 Ead d 0,02 ± 0,01
257,360 301 Ead d 0,05 ± 0,01
9 13,5 256,362 309 9030 9030 9030 9045 903 900 9030 9030 9030 903 900
10 14,0 258,378 1083 781/601 Пуникалагин А 3,05 ± 0,05
11 15,1 15,1 0.13 ± 0,09
12 15,9 257,361 301 Ead d 0,95 ± 0,03
13 2,69 ± 0,11
14 17,7 257,378 1083 781/601 Пуникалагин В 4,77 ± 0,21 8 257,362 301 Ead d 0,12 ± 0,01
16 25,2 256,363 29 9030 9030 9030 903 903 903 903 9030 905 309 900
17 29,3 254,361 301 Ead d 0,17 ± 0,01
18 32,2 32,2
0.08 ± 0,03
19 33,6 256,367 301 229/185 Эллаговая кислота 1,68 ± 0,01
20 0,08 ± 0,02
Всего полифенолов c 16,48 ± 2,49
Производные эллаговой кислоты 6,31
Эллаговая кислота
0,62
Итого 16.43

Масс-спектрометрические свойства 20 идентифицированных фенольных соединений (пики 1–20) показаны на рис. Как сообщалось ранее (Romeo et al., 2015), наблюдались две изомерные формы (A и B) пуникалагинов (пики 10 и 14), а также было подчеркнуто присутствие гранатина B (пик 6). Кроме того, эти соединения также были охарактеризованы прямым анализом отрицательных ионов для инфузии ESI / MS n стандартных соединений.Пик 4 был идентифицирован как пуникалин ( m / z 781), в то время как пики 2, 3, 5, 7–9, 11–13, 15–18 и 20 были идентифицированы как производные эллаговой кислоты в соответствии с их УФ – видимой областью и массой. характеристики (λ max около 370 нм и фрагмент MS 1 на мкм / z 301, соответствующий эллаговой кислоте).

Активность PE по улавливанию свободных радикалов

Антиоксидантная активность PE проверялась по их способности восстанавливать стабильный радикал DPPH.

В частности, процент ингибирования DPPH достигал 75% при концентрациях ниже 0.21 мг / мл (76,78, 79 и 80% соответственно при концентрации ПЭ 0,17-0,11-0,085 и 0,028 мг / мл). При концентрациях выше 0,21 мг / мл процент ингибирования DPPH был ниже ().

Активность ПЭ по улавливанию радикалов DPPH в различных концентрациях. Результаты выражаются в процентах от скорости ингибирования ± стандартное отклонение.

Экстракт граната ингибировал образование супероксид-аниона дозозависимым образом (). Как правило, в этом тесте PE оказался более эффективным, чем в предыдущем.Это может быть связано с меньшим размером супероксид-аниона по сравнению с радикалом DPPH.

Таблица 3

Активность по улавливанию супероксидных ионов при различных концентрациях ПЭ.

78 ± 2

концентрации PE % ингибирования концентрации PE % ингибирования
PE (3,4 мг / мл) 65 ± 2 PE (0,21 мг / мл)
PE (1,7 мг / мл) 73 ± 3 PE (0.17 мг / мл) 80 ± 1
PE (0,85 мг / мл) 75 ± 1 PE (0,11 мг / мл) 85 ± 3
PE (0,56 мг / мл ) 70 ± 2 PE (0,085 мг / мл 88 ± 4
PE (0,42 мг / мл) 68 ± 1 PE (0,028 мг / мл) 95 ± 1
PE (0,34 мг / мл) 75 ± 4

Влияние PE на жизнеспособность клеток 3T3-L1

3- (4,5-Диметилтиазол-2- ил) -2,5-дифенилтетразолийбромид (МТТ) проводили для оценки жизнеспособности клеток 3T3-L1.Результаты показывают значительное снижение жизнеспособности клеток при высоких концентрациях PE (3,4, 1,7, 0,85, 0,56 и 0,42 мг / мл), тогда как при более низких (0,34, 0,21, 0,17, 0,11 и 0,085 мг / мл) концентрациях наблюдается умеренная ингибирующий эффект и концентрация 0,028 мг / мл не оказали значительного влияния на жизнеспособность клеток преадипоцитов мышей 3T3-L1 ().

Процент выживаемости преадипоцитов мышей 3T3-L1 в присутствии PE в различных концентрациях. Результаты выражены как средние значения ± стандартное отклонение четырех экспериментов, проведенных в трех повторностях.Значимые по сравнению с необработанными контролями: * p <0,005; ∗∗ p <0,05.

Microbiology

Антимикробная активность PE в отношении штаммов патогенов

Данные анализа совместного культивирования показали, что патогены были по-разному чувствительны к PE. В деталях, как показано в, экстракт в концентрации 1,7 мг / мл показал наивысшую антимикробную активность против всех патогенов со значительным снижением на L. innocua (проксимально 4 log единицы).При концентрации 0,34 мг / мл экстракт был эффективен против E. coli , L. innocua и S. aureus , демонстрируя снижение плотности клеток на 1 и 2 log единицы соответственно. Когда PE тестировали при концентрации 0,17 мг / мл, штаммы S. aureus , S. enterica и L. innocua все еще подавлялись, в то время как рост E. coli существенно не влиял.

Противомикробная активность PE различной концентрации в отношении патогенов, обнаруженных в T24 (24 ч инокулята).Плотность клеток выражается как Δlog КОЕ / мл.

Эффект PE на рост пробиотических штаммов

Результаты, показанные в, подчеркнули, что PE, при всех испытанных концентрациях, не обладал какой-либо ингибирующей активностью в отношении роста испытанных пробиотических штаммов. Небольшое увеличение роста наблюдалось для LGG, совместно культивированного с PE в концентрации 0,028 мг / мл ().

Таблица 4

Количество бактерий, выраженное в виде log 10 КОЕ / мл в трех повторностях ± стандартное отклонение для L. rhamnosus GG ATCC 53103, Bifidobacterium animalis BB12, B.longum BB536 и дикий штамм Lactobacillus paracasei N 24 после инкубации с PE в различных концентрациях.

мл )

Б.longum

Log 10
L. rhamnosus GG Базовый уровень 8,83 ± 0,09 3 a

3

9,20 ± 0,10 b
PE (0.042 мг / мл) 9,24 ± 0,07 b
PE (0,028 мг / мл) 9,26 ± 0,04 b
Lactobacillus Paracasei 3 903 0,12 a
N24 PE (0,085 мг / мл) 8,70 ± 0,08 a
PE (0,042 мг / мл) 8,79 ± 0,10 a 5 PE (0.028 мг / мл) 8,74 ± 0,09 a
Bifidobacterium animalis Исходный уровень 9,15 ± 0,05 a
BB12 мг / ПЭ 0,12 a
PE (0,042 мг / мл) 9,44 ± 0,10 b
PE (0,028 мг / мл) 9,55 ± 0,07 b

5

Исходный уровень 9,77 ± 0,03 a
BB536 PE (0,085 мг / мл) 9,54 ± 0,10 a
мл PE (0,0330

мл) 9,57 ± 0,12 a
PE (0,028 мг / мл) 9,44 ± 0,16 a

Влияние полиэтилена на содержание липидов

и экстракт граната LGG- фильтрованный SB значительно снизил содержание триглицеридов по сравнению с контрольной группой ().Однако эффект отфильтрованного SB, полученного из клеток, инкубированных с PE (LGG-T1) или без него (LGG-T0), был аналогичным. Одновременная обработка преадипоцитов мышей 3T3-L1 SB, отфильтрованным через PE и LGG, значительно снизила содержание триглицеридов по сравнению с обработкой только SB, отфильтрованного через LGG. Более того, эти данные свидетельствуют о том, что комбинированное лечение PE и LGG-T1 было наиболее эффективным для снижения содержания триглицеридов и накопления внутриклеточных липидов.

(A) Типичное окрашивание O масляным красным О клеток 3T3-L1 в отсутствие и в присутствии PE, LGG T0, LGG T1, LGG T0 + PE и LGG T1 + PE. (B) Содержание липидов определяли количественно с помощью окрашивания Oil Red O (среднее ± SD , * p <0,05 по сравнению с контролем; # p <0,05 по сравнению с LGG T0 и LGG T1; § p <0,05 по сравнению с LGG T0 + PE).

Обработка преадипоцитов мышей 3T3-L1 клеточным экстрактом LGG (CE), полученным из клеток, инкубированных с PE (CE + PE) или без него (CE), не оказала влияния на накопление внутриклеточных липидов по сравнению с контрольной группой ( Контроль: ABS 490 нм = 0.200 ± 0,07; CE: ABS 490 нм = 0,187 ± 0,09; CE + PE = ABS 490 нм = 0,190 ± 0,05).

Влияние PE на адипогенные маркеры

Уровни экспрессии мРНК основных транскрипционных факторов, участвующих в дифференцировке адипоцитов, были значительно менее выражены в клетках 3T3-L1, обработанных SB, отфильтрованным через PE и LGG. В частности, PE, LGG-T0 и LGG-T1 были способны снижать уровни гена адипонектина, PPAR-γ, SREBP, FAS и IL-6 и повышать уровни гена IL-10 ().

(A – F) Анализ экспрессии генов с помощью qRT-PCR липогенного пути в клетках 3T3-L1 в отсутствие и в присутствии PE, LGG T0, LGG T1, LGG T0 + PE и LGG T1 + PE.Результаты выражены как средние значения ± стандартное отклонение четырех экспериментов, выполненных в трех повторностях ( * p <0,05 по сравнению с контролем; # p <0,05 по сравнению с LGG T0 и LGG T1; § p <0,05 по сравнению с контролем. LGG T0 + PE).

Одновременная обработка преадипоцитов мышей 3T3-L1 SB (LGGT0 и LGGT1), отфильтрованных через PE и LGG, значительно снизила уровни экспрессии мРНК основных транскрипционных факторов, участвующих в адипогенезе, по сравнению с обработкой SB, отфильтрованных через LGG ( LGGT0 и LGGT1) отдельно ().

Одновременная обработка преадипоцитов мышей 3T3-L1 SB (LGGT0 и LGGT1), отфильтрованных через PE и LGG, значительно увеличила уровни экспрессии мРНК IL10 по сравнению с обработкой только SB (LGGT0 и LGGT1), профильтрованных через LGG ( ). Более того, эти данные свидетельствуют о том, что комбинированное лечение PE + LGG T1 было наиболее эффективным в снижении уровней экспрессии мРНК адипонектина, IL-6, FAS и в повышении регуляции IL-10 (2).

Обсуждение

Благоприятные эффекты употребления плодов граната и / или сока вызвали значительный научный интерес (Basu and Penugonda, 2009).Многие исследователи сообщают, что полиэтилены, полученные из отходов перерабатывающих предприятий, обладают способностью улавливать свободные радикалы и обладают мощной антиоксидантной способностью (Panichayupakaranant et al., 2010; Fischer et al., 2011). ПЭ, используемый в настоящем исследовании, был растворим в воде и охарактеризован с помощью ВЭЖХ – PDA – ESI / MS n по содержанию фенолов и антоцианов. В соответствии с предыдущими сообщениями (Fischer et al., 2011; Qu et al., 2012; Romeo et al., 2015), эллагитаннины являются преобладающим классом фенольных соединений в кожуре и выжимках граната (побочный продукт, состоящий из семян и кожура), поскольку они составляют более 99% от общего содержания фенольных соединений граната.Основными эллагитаннинами побочных продуктов граната, а также продуктов из граната (фруктов и соков) являются пуникалагины (Gil et al., 2000; Fischer et al., 2011; Qu et al., 2012).

Экстракт граната содержит высокий процент фенольных соединений и проявляет антиоксидантную активность в зависимости от концентрации, как показано для анализа как DPPH, так и анализа поглощения супероксид-анионов.

Сообщалось, что диетические полифенолы растений способны избирательно модулировать рост чувствительных микроорганизмов (Tabasco et al., 2011). Экстракты растений обычно подавляют рост бактерий, но степень эффекта зависит от состава экстракта и типа бактериального штамма.

Результаты, полученные в наших экспериментальных условиях, показали, что высокие концентрации полифенолов граната оказывают противомикробное действие на некоторые штаммы патогенов, такие как L. innocua и S. aureus. Эти результаты согласуются с исследованиями Panichayupakaranant et al. (2010), Fawole et al.(2012) и Su et al. (2012).

Однако при концентрациях PE ниже 0,34 мг / мл, хотя не было обнаружено концентраций ингибирующей активности в отношении штаммов пробиотиков, оценивалось только небольшое увеличение роста LGG. Эти результаты не согласуются с исследованиями Li et al. (2015) и Neyrinck et al. (2013), которые продемонстрировали, что полифенолы граната потенциально могут работать как пребиотики.

Ожирение — это состояние, при котором накопление липидов приводит к расширению жировой ткани, которая действует как метаболический и эндокринный орган.Молекулярные механизмы, которые модулируют рост, дифференцировку и липогенез преадипоцитов жировых клеток, были предметом обширных исследований (Vanella et al., 2012; Stechschulte et al., 2014; Moseti et al., 2016; Palmeri et al., 2016; Waldman et al., 2016; Carpene et al., 2018).

Во время дифференцировки адипоцитов преадипоциты дифференцируются в зрелые адипоциты (Lefterova, Lazar, 2009). Повышенное накопление жира сильно коррелирует с количеством клеток и / или размером адипоцитов (Jiang et al., 2008).

Сообщалось, что степень ожирения связана с дифференцировкой преадипоцитов в адипоцитах и ​​с увеличением адипоцитов в жировой ткани (Wang and Jones, 2004).

Другие авторы сообщили, что PEs способны подавлять дифференцировку преадипоцитов и адипогенез и уменьшать жировую дистрофию печени у крыс с ожирением и диабетом 2 типа (Xu et al., 2009).

В соответствии с данными Moon et al. (2012) и Park et al. (2014) в наших экспериментальных условиях PE, LGG-T0 и LGG-T1 приводили к значительному снижению накопления липидов в клетках 3T3-L1 во время дифференцировки в адипоциты, предполагая, что PE, LGG-T0 и LGG-T1 способны подавлять дифференцировка адипоцитов.Однако обработка SB, отфильтрованного через LGG, полученного из клеток, инкубированных с PE (LGG-T1) или без него (LGG-T1), была аналогичной. В наших экспериментальных условиях фактически не наблюдалось пребиотического эффекта, продемонстрированного другими авторами. Более того, комбинированное лечение PE и LGG-T1 было наиболее эффективным в снижении накопления внутриклеточных липидов. Эти данные демонстрируют, что, даже если в наших экспериментальных условиях не наблюдалось пребиотического эффекта, фильтрованный SB, полученный из LGG, инкубированного с PE (LGG-T1), мог бы содержать, помимо полезных бактериальных секретируемых биоактивных соединений, также небольшие количества PE- производные биоактивные соединения.Последний, присутствующий в небольших количествах в LGG-T1, не будет иметь более сильных положительных эффектов, чем LGG-T0, но в сочетании с PE может иметь потенциальные синергетические преимущества для здоровья.

Адипоцит-специфический рецептор, активируемый пролифератором пероксисом-γ (PPARγ), участвует в ранней стадии дифференцировки адипоцитов (Rosen et al., 2000), регулируя экспрессию адипогенных генов, таких как синтаза жирных кислот (FAS) и регуляторный элемент стерола. -связывающие белки (SREBP), а затем запускают накопление жира в клетках (Kawada et al., 2001; Бергер и Моллер, 2002).

Жировая ткань — это не только первичный резервуар жира, но и эндокринный орган, контролирующий гомеостаз липидов. Измененные уровни адипокинов жировой ткани могут способствовать развитию воспаления, что приводит к нарушению липидного обмена (Armani et al., 2010). При хроническом воспалении провоспалительные цитокины, такие как IL-6, активируются, в то время как противовоспалительные цитокины, такие как IL-10, подавляются (Kershaw and Flier, 2004; Bradley et al., 2008; Лира и др., 2012; Лю и др., 2018).

Наши результаты демонстрируют, что комбинированное лечение PE + LGG-T1 значительно снижает уровень мРНК адипонектина, FAS и IL-6 и повышает уровень IL-10.

Мы можем сделать вывод, что комбинированное лечение PE + LGG-T1 обладает противовоспалительными свойствами и способно ингибировать дифференцировку адипоцитов, модулируя уровни экспрессии ключевых факторов адипогенной транскрипции, участвующих в адипогенезе.

Заключение

SB, профильтрованный экстрактом граната и LGG, значительно снижал накопление внутриклеточных липидов.Наблюдали синергетический эффект пробиотиков и полифенолов, содержащихся в PE. Более того, наши результаты показали, что комбинированное лечение PE + LGG T1 было наиболее эффективным в снижении уровней экспрессии мРНК адипонектина, IL-6, FAS и в повышении регуляции IL-10.

Эти результаты свидетельствуют о том, что пробиотики и полифенолы, содержащиеся в ПЭ, могут влиять на адипогенез in vitro. Более того, наши результаты демонстрируют, что синергетические свойства сочетания таких продуктов, как гранат и пробиотики, могут оказывать комбинированное воздействие на здоровье.

Тогда гранат и пробиотики, такие как штамм LGG, могут внести свой вклад в разработку новых нутрицевтических / пробиотических средств для профилактики и лечения ожирения.

Вклад авторов

VS, LV, CR, CC, FR и GB собрали исследовательские статьи, разработали эксперименты, проанализировали результаты и написали рукопись. CR, MR, SF и NT проводили эксперименты.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось в отсутствие каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Источники

  • Аль-Зореки Н.С. (2009). Антимикробная активность кожуры плодов граната ( Punica granatum L.).
    Внутр. J. Food Microbiol.
    134
    244–248. 10.1016 / j.ijfoodmicro.2009.07.002
    [PubMed] [CrossRef] [Google Scholar]
  • Армани А., Мамми К., Марзолла В., Каланчини М., Антелми А., Розано Г. М. и др. (2010). Клеточные модели для понимания адипогенеза, дисфункции жировой ткани и ожирения.
    J. Cell Biochem.
    110
    564–572.10.1002 / jcb.22598
    [PubMed] [CrossRef] [Google Scholar]
  • Барбагалло И., Ли Вольти Г., Сорренти В., Ди Джакомо К., Аквавива Р., Раффаэле М. и др. (2017). Фенетиловый эфир кофейной кислоты восстанавливает экспрессию гена адипоцитов после обработки липополисахаридом.
    Lett. Drug Des. Discov.
    14
    481–487. 10.2174 / 15701808136661604707 [CrossRef] [Google Scholar]
  • Бассири-Джахроми С. (2018). Активность Punica granatum (граната) в укреплении здоровья и профилактике рака. Онкол. Сборка
    12: 345. 10.4081 / онкол.2018.345
    [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Басу А., Пенугонда К. (2009). Гранатовый сок: фруктовый сок, полезный для сердца.
    Nutr. Сборка
    67
    49–56. 10.1111 / j.1753-4887.2008.00133.x
    [PubMed] [CrossRef] [Google Scholar]
  • Бергер Дж., Моллер Д. Э. (2002). Механизмы действия PPAR.
    Annu. Rev. Med.
    53
    409–435. 10.1146 / annurev.med.53.082901.104018 [PubMed] [CrossRef] [Google Scholar]
  • Бялонска Д., Касимсетти С. Г., Шредер К. К., Феррейра Д. (2009). Влияние побочных продуктов граната ( Punica granatum L.) и эллагитаннинов на рост кишечных бактерий человека.
    J. Agric. Food Chem.
    57 год
    8344–8349. 10.1021 / jf

    1b
    [PubMed] [CrossRef] [Google Scholar]

  • Бялонска Д., Рамнани П., Касимсетти С. Г., Мунта К. Р., Гибсон Г. Р., Феррейра Д. (2010). Влияние побочного продукта граната и пуникалагинов на отдельные группы кишечной микробиоты человека.
    Внутр.J. Food Microbiol.
    140
    175–182. 10.1016 / j.ijfoodmicro.2010.03.038
    [PubMed] [CrossRef] [Google Scholar]
  • Брэдли Р. Л., Фишер Ф. Ф., Маратос-Флиер Э. (2008). Пищевые жирные кислоты по-разному регулируют продукцию TNF-альфа и IL-10 адипоцитами 3T3-L1 мышей.
    Ожирение
    16
    938–944. 10.1038 / обы.2008.39
    [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Карпен К., Пеженауте Х., Дель Мораль Р., Буле Н., Хихона Э., Андраде Ф. и др. (2018). Диетический антиоксидант пицеатаннол ингибирует адипогенез мезенхимальных стволовых клеток жировой ткани человека и ограничивает транспорт глюкозы и липогенную активность в адипоцитах. Внутр. J. Mol. Sci.
    19: E2081. 10.3390 / ijms1

    81
    [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

  • Думал С. С., Карале А. Р., Джадхав С. Б., Кад В. П. (2014). Последние достижения и разработки в области обработки и использования граната: обзор.
    J. Agric. Crop Sci.
    1
    1–17. [Google Scholar]
  • Ди Джакомо К., Ванелла Л., Сорренти В., Сантанджело Р., Барбагалло И., Калабрезе Г. и др. (2015). Эффекты tithonia diversifolia (Hemsl.) A.Серый экстракт о дифференцировке адипоцитов мезенхимальных стволовых клеток человека.
    PLoS One
    10: e0122320. 10.1371 / journal.pone.0122320
    [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Фаволе О. А., Макунга Н. П., Опара Ю. Л. (2012). Метанольный экстракт кожуры плодов граната обладает антибактериальной, антиоксидантной и ингибирующей тирозиназой активностью.
    BMC Дополнение. Альтерн. Med.
    12: 200. 10.1186 / 1472-6882-12-200
    [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Fischer U.А., Карл Р., Каммерер Д. Р. (2011). Идентификация и количественное определение фенольных соединений из кожуры граната ( Punica granatum L.), мезокарпа, арил и других соков с помощью HPLC-DAD-ESI / MS (n).
    Food Chem.
    127
    807–821. 10.1016 / j.foodchem.2010.12.156
    [PubMed] [CrossRef] [Google Scholar]
  • Гил М. И., Томас-Барберан Ф. А., Хесс-Пирс Б., Холкрофт Д. М., Кадер А. А. (2000). Антиоксидантная активность гранатового сока и ее связь с фенольным составом и обработкой. J. Agric. Food Chem.
    48
    4581–4589. [PubMed] [Google Scholar]
  • Хоссин Ф. Л. А. (2009). Воздействие кожуры граната (Punica granatum) и его экстракта на крыс с ожирением и гиперхолестеринемией.
    Пак. J. Nutr.
    8
    1251–1257. 10.3923 / pjn.2009.1251.1257 [CrossRef] [Google Scholar]
  • Jiang L., Zhang N. X., Mo W., Wan R., Ma C. G., Li X., et al. (2008). Ремания подавляет дифференцировку адипоцитов и адипогенез.
    Biochem. Биофиз. Res. Commun.
    371
    185–190.10.1016 / j.bbrc.2008.03.129
    [PubMed] [CrossRef] [Google Scholar]
  • Кавада Т., Такахаши Н., Фушики Т. (2001). Биохимические и физиологические характеристики жировой клетки.
    J. Nutr. Sci. Витаминол.
    47
    1–12. [PubMed] [Google Scholar]
  • Кершоу Э. Э., Флиер Дж. С. (2004). Жировая ткань как эндокринный орган.
    J. Clin. Эндокринол. Метаб.
    89
    2548–2556. 10.1210 / jc.2004-0395
    [PubMed] [CrossRef] [Google Scholar]
  • Ким С. Х., Плутцки Дж. (2016). Бурый жир и потемнение для лечения ожирения и связанных с ним нарушений обмена веществ. Diabetes Metab. J.
    40
    12–21. 10.4093 / dmj.2016.40.1.12
    [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Лай С., Цай М. Л., Бадмаев В., Хименес М., Хо К. Т., Пан М. Х. (2012). Ксантиген подавляет дифференцировку преадипоцитов и адипогенез за счет подавления PPARgamma и C / EBP и модуляции путей SIRT-1, AMPK и FoxO.
    J. Agric. Food Chem.
    60
    1094–1101. 10.1021 / jf204862d
    [PubMed] [CrossRef] [Google Scholar]
  • Ли К.Дж., Чен Л. Г., Лян В. Л., Ван К. С. (2010). Противовоспалительное действие punica granatum Linne in vitro и in vivo.
    Food Chem.
    118
    315–322. [Google Scholar]
  • Лефтерова М. И., Лазарь М. А. (2009). Новые разработки в адипогенезе.
    Trends Endocrinol. Метаб.
    20
    107–114. 10.1016 / j.tem.2008.11.005
    [PubMed] [CrossRef] [Google Scholar]
  • Лес Ф., Арбонес-Майнар Дж. М., Валеро М. С., Лопес В. (2018). Полифенолы граната и уролитин А ингибируют альфа-глюкозидазу, дипептидилпептидазу-4, липазу, накопление триглицеридов и гены, связанные с адипогенезом, в адипоцитоподобных клетках 3T3-L1. J. Ethnopharmacol.
    220
    67–74. 10.1016 / j.jep.2018.03.029
    [PubMed] [CrossRef] [Google Scholar]
  • Ли Ю. Ф., Го К. Дж., Ян Дж. Дж., Вэй Дж. Ю., Сюй Дж., Ченг С. (2006). Оценка антиоксидантных свойств экстракта кожуры граната по сравнению с экстрактом мякоти граната.
    Food Chem.
    96
    254–260. [Google Scholar]
  • Ли З., Сумманен П. Х., Комория Т., Хеннинг С. М., Ли Р. П., Карлсон Э. и др. (2015). Эллагитаннины граната стимулируют рост кишечных бактерий in vitro: влияние на пребиотические и метаболические эффекты. Анаэроб
    34
    164–168. 10.1016 / j.anaerobe.2015.05.012
    [PubMed] [CrossRef] [Google Scholar]
  • Лин Л. Т., Чен Т. Ю., Лин С. С., Чунг С. Ю., Лин Т. К., Ван Г. Х. и др. (2013). Противовирусная активность широкого спектра хебулаговой кислоты и пуникалагина против вирусов, которые используют гликозаминогликаны для проникновения.
    BMC Microbiol.
    13: 187. 10.1186 / 1471-2180-13-187
    [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Лира Ф. С., Роза Дж. К., Пиментел Г. Д., Силаендер М., Дамасо А. Р., Ояма Л. М. и др. (2012). И адипонектин, и интерлейкин-10 ингибируют LPS-индуцированную активацию пути NF-kappaB в адипоцитах 3T3-L1.
    Цитокин
    57 год
    98–106. 10.1016 / j.cyto.2011.10.001
    [PubMed] [CrossRef] [Google Scholar]
  • Лю Ю., Сюй Д., Инь С., Ван С., Ван М., Сяо Ю. (2018). Уровень IL-10 / STAT3 снижается при детском ожирении с гипертриглицеридемией и связан с уровнем триглицеридов у крыс с ожирением, вызванным диетой.
    BMC Endocr. Disord.
    18:39.10.1186 / s12902-018-0265-z
    [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Мун Й. Дж., Сох Дж. Р., Ю Дж. Дж., Сон Х. С., Ча Й. С., О С. Х. (2012). Эффект ингибирования внутриклеточного накопления липидов Weissella koreensis OK1-6, выделенного из Kimchi, на дифференцирующиеся адипоциты.
    J. Appl. Microbiol.
    113
    652–658. 10.1111 / j.1365-2672.2012.05348.x
    [PubMed] [CrossRef] [Google Scholar]
  • Мосети Д., Регасса А., Ким В. К. (2016). Молекулярная регуляция адипогенеза и потенциальные антиадипогенные биоактивные молекулы. Внутр. J. Mol. Sci.
    17: E124. 10.3390 / ijms17010124
    [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Нейринк А. М., Ван Хи В. Ф., Биндельс Л. Б., Де Бакер Ф., Кани П. Д., Дельзен Н. М. (2013). Богатый полифенолами экстракт кожуры граната облегчает воспаление тканей и гиперхолестеринемию у мышей с ожирением, вызванных диетой с высоким содержанием жиров: потенциальное влияние на микробиоту кишечника.
    Br. J. Nutr.
    109
    802–809. 10.1017 / S0007114512002206
    [PubMed] [CrossRef] [Google Scholar]
  • Палмери Р., Монтелеоне Дж. И., Спанья Г., Рестучча К., Раффаэле М., Ванелла Л. и др. (2016). Экстракт оливковых листьев сицилийского сорта уменьшал накопление липидов, вызывая термогенный путь во время адипогенеза.
    Фронт. Pharmacol.
    7: 143. 10.3389 / fphar.2016.00143
    [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Panichayupakaranant P., Tewtrakul S., Yuenyongsawad S. (2010). Антибактериальное, противовоспалительное и противоаллергическое действие стандартизированного экстракта кожуры граната. Food Chem.
    123
    400–403. 10.1055 / s-0030-1264706 [CrossRef] [Google Scholar]
  • Парк Дж. Э., О С. Х., Ча Ю. С. (2014). Lactobacillus brevis OPK-3, выделенный из кимчи, подавляет адипогенез и оказывает противовоспалительное действие в адипоцитах 3T3-L1.
    J. Sci. Продовольственное сельское хозяйство.
    94
    2514–2520. 10.1002 / jsfa.6588
    [PubMed] [CrossRef] [Google Scholar]
  • Ку В., Брекса III А. П., Пан З., Ма Х. (2012). Количественное определение основных составляющих полифенолов в продуктах из граната. Food Chem.
    132
    1585–1591. 10.1016 / j.foodchem.2011.11.106
    [PubMed] [CrossRef] [Google Scholar]
  • Раффаэле М., Барбагалло И., Ликари М., Карота Г., Сферраццо Г., Спампинато М. и др. (2018). N-ацетилцистеин (NAC) улучшает липидную метаболическую дисфункцию в адипоцитах, происходящих из стромальных клеток костного мозга.
    Evid. На основе дополнения. Альтерн. Med.
    2018: 9. 10.1155 / 2018/5310961
    [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Редди М. К., Гупта С.К., Джейкоб М. Р., Хан С. И., Феррейра Д. (2007). Антиоксидантное, противомалярийное и противомикробное действие богатых танинами фракций, эллагитаннинов и фенольных кислот из Punica granatum L.
    Planta Med.
    73
    461–467. 10.1055 / с-2007-967167
    [PubMed] [CrossRef] [Google Scholar]
  • Ромео Ф. В., Баллистрери Г., Фаброни С., Пангалло С., Никосия М. Г., Шена Л. и др. (2015). Химическая характеристика различных экстрактов сумаха и граната, эффективных против гнили Botrytis cinerea. Молекулы
    20
    11941–11958. 10,3390 / молекул 200711941
    [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Розен Э. Д., Уолки К. Дж., Пуигсервер П., Шпигельман Б. М. (2000). Транскрипционная регуляция адипогенеза.
    Genes Dev.
    14
    1293–1307. [PubMed] [Google Scholar]
  • Салерно Л., Модика М. Н., Ромео Г., Питтала В., Сиракуза М. А., Амато М. Э. и др. (2012). Новые ингибиторы синтазы оксида азота с антиоксидантными свойствами.
    Eur.J. Med. Chem.
    49
    118–126. 10.1016 / j.ejmech.2012.01.002
    [PubMed] [CrossRef] [Google Scholar]
  • Синглтон В. Л., Ортофер Р., Ламуэла-Равентос Р. М. (1999). Анализ общих фенолов и других субстратов окисления и антиоксидантов с помощью реактива Фолина – Чокальто.
    Methods Enzymol.
    299
    152–178. 10.1016 / S0076-6879 (99) 99017-1 [CrossRef] [Google Scholar]
  • Смит К. Б., Смит М. С. (2016). Статистика ожирения.
    Prim Care
    43 год
    121–135. 10.1016 / j.поп.2015.10.001
    [PubMed] [CrossRef] [Google Scholar]
  • Штехшульте Л. А., Хайндс Т. Д., мл., Худер С. С., Шоу В., Наджар С. М., Санчес Э. Р. (2014). FKBP51 контролирует клеточный адипогенез посредством опосредованного p38 киназой фосфорилирования GRalpha и PPARgamma.
    Мол. Эндокринол.
    28 год
    1265–1275. 10.1210 / мне.2014-1022
    [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Su X., Howell A. B., D’Souza D. H. (2012). Антибактериальные эффекты растительных экстрактов на устойчивый к метициллину Staphylococcus aureus. Пищевой патоген. Дис.
    9
    573–578. 10.1089 / fpd.2011.1046
    [PubMed] [CrossRef] [Google Scholar]
  • Табаско Р., Санчес-Патан Ф., Монагас М., Бартоломе Б., Виктория Морено-Аррибас М., Пелаез К. и др. (2011). Влияние полифенолов винограда на рост молочнокислых бактерий и бифидобактерий: устойчивость и метаболизм.
    Food Microbiol.
    28 год
    1345–1352. 10.1016 / j.fm.2011.06.005
    [PubMed] [CrossRef] [Google Scholar]
  • Тегеранифар А., Селахварзи Ю., Харрази М., Бахш В.J. (2011). Высокий потенциал побочных продуктов агропромышленного производства граната ( Punica granatum L.) как мощных противогрибковых и антиоксидантных веществ.
    Ind. Сельскохозяйственная продукция
    34
    1523–1527. 10.1016 / j.indcrop.2011.05.007 [CrossRef] [Google Scholar]
  • Ванелла Л., Барбагалло И., Аквавива Р., Ди Джакомо К., Кардил В., Абрахам Н. Г. и др. (2013a). Эллаговая кислота: цитодифференцирующие и антипролиферативные эффекты в клеточных линиях рака предстательной железы человека.
    Curr. Pharm.Des.
    19
    2728–2736. [PubMed] [Google Scholar]
  • Ванелла Л., Ди Джакомо К., Аквавива Р., Барбагалло И., Кардил В., Ким Д. Х. и др. (2013b). Маркеры апоптоза в клеточной линии рака простаты: эффект эллаговой кислоты.
    Онкол. Реп.
    30
    2804–2810. 10.3892 / или 2013.2757
    [PubMed] [CrossRef] [Google Scholar]
  • Ванелла Л., Ди Джакомо К., Аквавива Р., Барбагалло И., Ли Вольти Г., Кардил В. и др. (2013c). Влияние эллаговой кислоты на ангиогенные факторы в клетках рака простаты. Раки
    5
    726–738. 10.3390 / раки5020726
    [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Ванелла Л., Сэнфорд С., младший, Ким Д. Х., Абрахам Н. Г., Эбрахейм Н. (2012). Окислительный стресс и гемоксигеназа-1 регулируют дифференцировку мезенхимальных стволовых клеток человека.
    Внутр. J. Hypertens.
    2012: 8

    . 10.1155 / 2012/8

    [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Waldman M., Bellner L., Vanella L., Schragenheim J., Sodhi K., Singh S.P., et al. (2016). Эпоксиэйкозатриеновые кислоты регулируют дифференцировку адипоцитов клеток 3T3 мыши посредством активации PGC-1alpha, которая необходима для экспрессии HO-1 и увеличения функции митохондрий.
    Stem Cells Dev.
    25
    1084–1094. 10.1089 / scd.2016.0072
    [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Wang Y. W., Jones P. J. (2004). Конъюгированная линолевая кислота и контроль ожирения: эффективность и механизмы.
    Внутр. J. Obes. Relat. Метаб. Disord.
    28 год
    941–955.10.1038 / sj.ijo.0802641
    [PubMed] [CrossRef] [Google Scholar]
  • Сюй К. З., Чжу К., Ким М. С., Ямахара Дж., Ли Ю. (2009). Цветок граната уменьшает ожирение печени у животных с диабетом 2 типа и ожирением.
    J. Ethnopharmacol.
    123
    280–287. 10.1016 / j.jep.2009.03.035
    [PubMed] [CrossRef] [Google Scholar]

12 многообещающих преимуществ кожуры граната для кожи, волос и здоровья

Кожура граната обладает множеством лечебных свойств и используется для лечения нескольких заболеваний.Говорят, что он обладает антибактериальными, противогрибковыми, противовирусными и противовоспалительными свойствами, а также многими преимуществами для здоровья. Кожура граната богата антиоксидантами и может бороться с прыщами, выводить токсины из организма, предотвращать появление морщин и признаков старения, а также лечить боль в горле и кашель. Вместо того, чтобы выбрасывать их, храните их, чтобы получить их чудесные преимущества. В этой статье мы обсудили потенциальные преимущества кожуры граната, процесс изготовления порошка кожуры и некоторые рецепты.

Польза кожуры граната для здоровья

1.Может бороться с прыщами, прыщами и высыпаниями

Считается, что кожура граната обладает антибактериальными, противовирусными и противовоспалительными свойствами (1). Она может эффективно бороться с такими кожными проблемами, как прыщи, прыщи и сыпь. Кожура богата антиоксидантами и помогает сдерживать бактерии и другие инфекции (2). Неофициальные данные свидетельствуют о том, что кожура граната также может помочь в удалении омертвевших клеток кожи с лица, если его использовать в виде маски для лица или скраба для лица. Однако необходимы дополнительные исследования, чтобы понять преимущества кожуры граната.

2. Может помочь в детоксикации организма

Антиоксиданты активно борются с токсичными веществами в организме. Следовательно, высокое содержание антиоксидантов в кожуре граната является эффективным средством при использовании для детоксикации организма. Исследование, проведенное на мышах, показало, что водный экстракт кожуры граната может способствовать детоксикации (3). Считается, что он очень полезен для борьбы с токсинами, присутствующими в организме. Однако в этом контексте доступны ограниченные данные.

3. Может предотвратить появление морщин и других признаков старения

Чрезмерное пребывание на солнце и загрязнение окружающей среды — две основные причины преждевременного старения.Исследования показывают, что экстракт кожуры граната при использовании с маслом семян способствует синтезу проколлагена, борется с ферментами, расщепляющими коллаген, и эффективно способствует росту клеток кожи. Таким образом, он естественным образом и эффективно замедляет старение кожи и появление морщин (4).

Исследование, проведенное Университетом Халлим (Корея) на клетках кожи человека и лысых мышах, показало, что эллаговая кислота, содержащаяся в экстрактах кожуры граната, может уменьшать морщины (5) . Таким образом, это может помочь вашей коже выглядеть моложе.

4. Может вылечить боль в горле и кашель

Согласно традиционной лечебной практике, кожура граната помогает облегчить кашель и используется в порошкообразной форме с водой в качестве полоскания для облегчения боли в горле (6). Многочисленные исследования показывают, что водно-спиртовой экстракт кожуры граната обладает антибактериальными свойствами, которые могут помочь при лечении боли в горле и кашля (7), (8).

5. Может действовать как естественный увлажнитель и солнцезащитный крем

По этому поводу имеются ограниченные данные.Тем не менее, неофициальные данные свидетельствуют о том, что эллаговая кислота, содержащаяся в кожуре граната, может предотвратить высыхание влаги в клетках кожи, тем самым сохраняя вашу кожу увлажненной. Кроме того, считается, что кожура граната увлажняет и защищает кожу от токсинов окружающей среды и восстанавливает ее баланс pH. Они также используются в средствах по уходу за кожей из-за их увлажняющих свойств.

Кожура граната содержит эффективные средства для защиты от загара и действует как естественный солнцезащитный крем, предотвращая и восстанавливая повреждения, нанесенные коже лучами UVA и UVB (9).

6. Может бороться с раком кожи

Новое удивительное исследование показало, что экстракты граната содержат профилактический агент, который борется с возникновением рака кожи (10). Предполагается, что противовоспалительные и противораковые свойства кожуры граната эффективны в профилактике и лечении рака кожи. Кожура граната предотвращает процесс разрастания раковых клеток, тем самым снижая риск рака кожи. Однако в этом отношении доступно очень мало исследований, и необходимы более долгосрочные исследования, чтобы понять преимущества кожуры граната для людей.

7. Богатый источник витамина C

Витамин C, еще одно необходимое питательное вещество, для которого мы часто покупаем дорогие добавки, в изобилии содержится в кожуре граната (11), (12). Витамин С — это средство экстенсивного роста, которое помогает заживлять раны и формировать рубцовую ткань. Он образует белки для наращивания массы тела и играет важную роль в восстановлении и поддержании хрящей, костей и зубов (13).

8. Может защитить от болезней сердца

Кожура граната богата антиоксидантами, которые обладают высокой способностью защищать холестерин ЛПНП от окисления.Также считается, что он обладает васкулопротекторным действием, предотвращающим проблемы с сердцем (14). Это полезно, потому что окисление холестерина ЛПНП в организме может привести к окислительному стрессу, который является основным фактором, способствующим сердечным заболеваниям и другим недугам (15).

9. Может улучшить гигиену зубов

Гранатовая корка часто используется в зубных порошках и пастах. Считается, что эти пилинги обладают антибактериальным и противокариесным действием, что помогает справиться с множеством стоматологических проблем, таких как гингивит, зубной налет, кариес и язвы во рту (16).Однако необходимы более долгосрочные исследования, чтобы понять преимущества кожуры граната.

10. Может улучшить здоровье костей.

Гранатовая кожура эффективно снижает потерю плотности костей. Исследования показывают, что употребление смесей из кожуры граната может помочь улучшить здоровье костей и предотвратить возникновение остеопороза после менопаузы. В исследовании говорится, что кожура граната богата дубильными веществами, полифенолами и флавоноидами, а потребление его экстракта в качестве пищевой добавки благотворно влияет на здоровье костей (17).

11. Может улучшить здоровье кишечника

Кожура граната содержит дубильные вещества, которые помогают уменьшить воспаление кишечника благодаря своим противовоспалительным свойствам (18). Кроме того, кожура фруктов помогает уменьшить отек геморроя (19). Некоторые неофициальные данные свидетельствуют о том, что кожура граната также помогает остановить кровотечение во время диареи и улучшает здоровье пищеварительной системы.

12. Может остановить выпадение волос и предотвратить перхоть

Экстракты кожуры граната эффективно используются для борьбы с выпадением волос и профилактического контроля перхоти.Противогрибковая активность кожуры граната помогает уменьшить выпадение волос, вызванное грибковой активностью, и предотвращает появление перхоти (20), (21). Однако в этом отношении доступны ограниченные исследования.

Теперь, когда вы знаете все о пользе кожуры граната для здоровья, давайте посмотрим, как почистить гранат.

Как почистить гранат

  1. Используя острый нож, отрежьте верх и низ граната.
  2. Надрежьте кожицу граната сверху вниз.Сделайте 4 надреза, чтобы получилось 4 равных разреза. Только прорежьте кожу, останавливаясь при ударе по белой части.
  3. Поместите гранат в воду и начните ломать его вдоль надрезов, которые вы сделали ранее, чтобы разделить 4 части.
  4. Вытяните семена от кожицы. Семена опустятся на дно чаши, а кожица / косточка всплывет наверх.
  5. Перед тем, как процедить, снимите верхнюю часть воды и удалите лишнюю кожицу и мякоть.

Вот как можно приготовить порошок кожуры граната в домашних условиях.

Как сделать гранатовый порошок

Чтобы приготовить гранатовый порошок в домашних условиях, выполните следующие действия.

  • Возьмите четыре-пять плодов граната и разрежьте каждый плод на четыре части в продольном направлении.
  • Удалите все семена и отделите кожуру.
  • Далее каждую кожуру разрезать на две половинки.
  • Если вы хотите использовать пилинг в терапевтических целях, снимите ножом желтую часть под красной кожей. Это связано с тем, что желтая часть, когда она высушена и измельчена, может придать вашим смесям горький привкус.Однако, если вы используете кожуру для наружного применения, желтую часть можно оставить нетронутой.
  • Положите кожуру на тарелку или сухую ткань и поставьте под прямые солнечные лучи. Дайте им высохнуть.
  • Оставьте кожуру на солнце, пока она не затвердеет и не потеряет всю влагу.
  • Положите все высушенные на солнце кожуры в чистый сухой кухонный комбайн и измельчите в течение двух минут, пока не получите мелкий порошок.
  • Храните порошок в чистой герметичной стеклянной банке.

Рецепты

1.Цедра граната Тамбли

Ингредиенты

  • Цедра граната — кусок 3 дюйма
  • Натертый на терке кокос — 1/2 стакана
  • Разбавленный йогурт — 1/2 стакана
  • Перец — 1/2 чайной ложки
  • семян — 1/2 чайной ложки

  • Соль — 3/4 чайной ложки
  • Растительное масло — 1 чайная ложка
  • Семена горчицы — 1/2 чайной ложки
  • Несколько листьев карри

Указания

  1. В сковороду добавить немного масла и цедры граната, перец и семена тмина.Жарьте их, пока кожура граната не станет слегка хрустящей или не изменит цвет.
  2. В миксере-мясорубке добавьте тертый кокос и обжаренные ингредиенты из шага 1. Добавьте немного соли и измельчите смесь до тонкой пасты.
  3. Смешайте пасту с разбавленным йогуртом. Это тамбли.
  4. В сковороду добавьте немного масла, семена горчицы и листья карри. Когда семена горчицы лопнут, вылейте содержимое сковороды поверх тамбли.

Воспользуйтесь преимуществами тамбли из кожуры граната при лечении диареи в домашних условиях.

2. Травяной чай с гранатом

Ингредиенты

  • Гранатовый порошок — 1 чайная ложка
  • Листья мяты
  • Имбирь
  • Семена тмина
  • Органические листья зеленого чая 9132
  • Направления 9132
  • Органические листья зеленого чая
  • Направления

    1. Положите все травы в кофемолку и измельчите их до мелкого порошка.
    2. Добавьте 1 чайную ложку смеси в 1 1 / 4 стакана воды и доведите до кипения в течение 1 минуты.
    3. Снимите смесь с плиты и дайте настояться 5 минут. Процедите чай и добавьте мед.

    Вы можете использовать этот гранатовый порошок практически в любых травяных смесях.

    Заключение

    Гранаты известны своим вкусом и пользой для здоровья. Однако кожура этого фрукта также обладает невероятными свойствами, которые могут лечить многие недуги. Считается, что эти пилинги обладают антимикробными и противовоспалительными свойствами и могут бороться со многими проблемами кожи и здоровья.Так что в следующий раз не теряйте кожуру этого фрукта. Храните его в виде порошка и используйте его, чтобы пожинать плоды.