Орхидей размножения: Страница не найдена — Мир орхидей: фаленопсис

Содержание

Размножение орхидей

Образование деток на фаленопсисе

Размножают орхидеи черенками, детками, делением куста, семенами и бульбами. Черенками размножается редкие орхидеи — драгоценные: Лудизии и Макодес, и их гибриды, ну и Ваниль Vanilla planifolia. Остальные орхидеи детками, делением или семенами.

Размножение орхидей делением

При размножении делением, можно разъединять куст на части с корнями. При этом на каждой части желательно оставить по три ростка, что бы растения оказались жизнеспособными. Места срезов присыпают толченым углем.

Можно отделить старую бульбу у отцветших орхидей (например, эпидендрум). Старые бульбы, которые потеряли листья, отделяют и помещают над влажной средой на укоренение. Можно налить в миску воды, положить над ней решетку, на нее бульбу, так чтобы она не касалась воды, но вокруг создавалась повышенная влажность. Температура должна быть не ниже 20°С. Через некоторое время из почек у основания старой бульбы появляются новые растения на собственных корнях. Когда они достаточно отрастут (1-1,5 см), их можно рассаживать в горшки.

Для укоренения псевдобульб используют всевозможные теплички для поддержания высокой влажности. В ход идет все – любые прозрачные контейнеры, коробки от торта, одноразовая посуда, пяти-шести литровые бутылки из-под воды, небольшие аквариумы, пузатые пиалы и т.д.

Дендробиум посажен в смесь из коры и мха сфагнума, с добавлением кусочков пенопласта и торфа.

Размножение орхидей черенками

Для размножения черенками берут старые, удлиненные стебли, боковые побеги или отцветшие цветочные стебли. Черенки берут около 10-15 см длиной.

Срезанный черенок не втыкают в землю, как у других комнатных растений, а кладут плашмя на поверхность почвы (песка или мха) и помещают его в тепличку, желательно с подогревом. Можно размножать орхидеи не срезанием черенков, а отводкой стебля в соседний горшок, отрезать его от материнского растения после укоренения.

Способ укоренения: разрезам 1,5 литровую прозрачную бутылку на две части (низ и верх). В нижнюю кладем влажный мох, на него из решетки для раковины вырезаем круг, вставляем его так, чтобы он располагался чуть выше мха. На него кладем черенок орхидеи — то, что должно укорениться. Закрываем сверху верхом от бутылки, при этом крышка бутылки должна быть отвинчена всегда, так в тепличку поступает воздух. Черенок не должен касаться мха, чтобы не было загнивания, а влажность внутри бутылки получается высокая (около 80%).

Молодые орхидеи, полученные при размножении от черенка, или путем деления куста, или другим способом? поливают очень осторожно, еще лучше вместо полива применять опрыскивание, до образования хороших крепких корней. В воду для полива можно добавлять биофунгицид Фитоспорин-М, или можно в горшочек с субстратом положить таблетку «Алирин Б». Но фитоспорин-М лучше.

Орхидеи семенами

Орхидеи легко скрещиваются при переопылении в пределах не только одного вида, но и между отдельными родами. Поэтому способ размножения семенами чаще используют для получения новых сортов орхидей.

Теоретически, в размножении орхидей семенами нет ничего сложного, но есть одно условие, которое в домашних условиях воспроизвести довольно сложно — это стерильность среды. Здесь недостаточно простерилизовать грунт в духовке и протравить семена марганцовкой, как с любыми другими комнатными растениями, стерильность нужна во всем — от начала процесса — обеззараживания инструмента, грунта, семян, до полного запечатывания семян in vitro. Т.е. примерно также как мы закатываем на зиму заготовки, нужно поместить семена в стерильную среду.

Семена орхидей пылевидные, если быть точными, то размеры около 0,25-1,5 мм длиной и 0,27-0,9 мм шириной, а в одном плоде сотни тысяч семян. Зреют семена орхидей по-разному, например у фаленопсисов это занимает от 4 до 6 месяцев. Когда созревший плод трескается и семена вылетают из него, такие мелкие размеры способствуют легкому переносу семян с потоками воздуха, они попадают в мельчайшие трещины коры деревьев и благополучно развиваются на высоте несколько метров от земли.

Но все у орхидей не как у обычных растений: прорастание семян происходит с неизменным участием симбиотических грибов (определенных видов). Самые известные исследования в мире науки принадлежат французскому ботанику Ноэлю Бернару. Он поведал миру о том, что семена орхидей не просто так имеют мелкие размеры, в них практически нет питательных веществ, необходимых для роста и развития. Для орхидей эти питательные вещества производят симбиотические грибы.

При благоприятных условиях, происходит заражение или инфицирование семян. Не спорами — нет, это явление называется ризоктония — это бесплодная форма мицелия — тончайшие нити гриба проникают в семя и разрастаются внутри клетки зародыша, образуя небольшие клубочки. Причем рост этих клубочков не должен быть инвазивным, т.е. у крепкого здорового семени грибы не могут препятствовать его росту, так как клеточный сок имеет фунгицидное действие и сдерживает развитие гриба более, чем необходимо самой будущей орхидее.

Т. о. грибы обеспечивают растение необходимым питанием, и семя развивается и прорастает. Это явление симбиотической ассоциации мицелия гриба с корнями высших растений (присуще не только орхидным, но и многим другим растениям) называется микоризой.

После проникновения в семя и развития гиф микоризного гриба, появляется проросток, у орхидных он называется Протокорм — это образование, состоящее из одинаковых паренхимных клеток. Предполагается, что уже на стадии протокорма можно определить, если не видовую, то хотя бы родовую принадлежность орхидеи. У большинства эпифитов протокорм округлой формы, у наземных — несколько вытянутый.

На этом этапе надо вспомнить, что из одного плода, извергшего сотни и даже миллионы микроскопических семян, далеко не из каждого вырастает орхидея. Большинство семян просто погибает. Дело в том, что попытка симбиоза — это не всегда хэппиэнд, а грибы, заражающие и способные питать семена орхидей, далеко не так безобидны, как могло показаться. Если семена не вырабатывают некие фунгицидные вещества или вырабатывают их в недостаточном количестве, ризоктонии гриба их просто уничтожают. Таким образом, в природных условиях из семян орхидей выживают лишь единицы.

Если пытаться выращивать орхидеи в домашних условиях также как в природных — просто посеять, то шансы выжить невелики. Но ученые биологи выяснили, что если посеять семена орхидей на стерильную среду, где нет никакого намека на ризоктонии грибов, но предоставить питательные элементы, то многие виды орхидей прорастают в огромных количествах. И хотя растет проросток орхидеи достаточно долго, полностью развивается примерно за 180-200 дней, и только в возрасте от 300 дней (обычно дольше 400-500 дней в зависимости от вида) готов к пересадке в субстрат, это открытие позволило развернуть масштабное выращивание орхидей в пробирке.

Кстати, по имени профессора Льюиса Кнудсона, раствор получил название «питательная среда Кнудсона».

Среда Кнудсона

на 1 л дистиллированной воды:

  • Ca(NO3)2*4h3O — 1,0 г
  • Kh3PO4 — 0,25 г
  • MgSO4*7h3O — 0,25 г
  • FeSO4*7h3O — 0,025 г
  • (Nh5)2SO4 — 0,5 г
  • MnSO4*4h3O — 0,0075 г
  • Сахароза — 20,0 г
  • Агар-агар — 7,0 г

Компоненты перечислены в порядке добавления в воду. Чтоб агар-агар растворился, необходимо, постоянно помешивая довести раствор до кипения. Плюс к полученному раствору добавляется растительная компонента — фруктовое или ягодное пюре, примерно 8 г, лучше банановое, можно папайю, мякоть томата. Дольки фрукта измельчают и протирают через сито.

Однако, понятие питательной среды не ограничилось так сказать, классикой. Изобретательные цветоводы придумали массу питательных растворов, вот пример:

Питательный раствор для посева орхидей

на 1 литр дистиллированной воды:

  • 1,5 г удобрения для орхидей (равное NPK 20-20-20)
  • 30 г сахара
  • 1 г активированного угля, толченого в ступке,
  • 5 капель эпина (или нафталинуксусная кислоты)
  • 8 г агар-агара

Агар-агар — выполняет функцию загустителя, т.е. чтобы семена не плавали в растворе, а лежали на поверхности. Его нельзя заменить желатином — не переносит стерилизации, при высокой температуре теряет свои свойства застывать в студень. Поэтому достойной альтернативы агар-агару пока не придумали.

В питательный раствор часто добавляют фруктовый сок или фруктовое пюре. Если удобрение для орхидей содержит только минералы и соли, то фруктовая компонента нужна как источник ауксинов, гибберилинов, кинетина (ростовые вещества растений), а также витаминов и др. биологически активных веществ, необходимых для полноценного развития сеянцев. Кстати, цитокинины, и в том числе, кинетин, — это класс гормонов растений 6-аминопуринового ряда, стимулирующих деление клеток, впервые обнаружены в приличном количестве в кокосовом молоке.

Поэтому в иностранных рецептах питательных сред для посева орхидей часто можно встретить добавление вместо фруктового пюре — кокосового молока. Т.е. вы просто берете кокосовый орех, делаете в нем дырку и сливаете жидкость. На 1 литр питательной среды нужно 100 г кокосовой воды и 900 мг дистиллированной воды, затем все остальные компоненты по списку. Замечено, что на кокосовой воде сеянцы развиваются лучше (хотя данные скорее субъективны).

Сахар нужен орхидеям по той причине, что как мы помним, своих питательных веществ у них очень мало, а для развития сеянцев необходимы простые углеводы, поэтому без сахара не обойтись.

Активированный уголь раньше в среду для посева не добавляли, но замечено, что он сдерживает загрязнение — от мешанины фруктовых пюре, частичек семенной оболочки, если попадут с семенами, и через 3-4 недели прорастания, рост сеянцев замедляется. При добавлении угля этого не происходит, что позволяет обойтись без лишней пересадки сеянцев в новую стерильную среду. Т.е. если места достаточно (семян высеяно немного в одну банку), то с активированным углем сеянцы могут прекрасно расти 4-5 месяцев, а то и вовсе обойтись без пересадок до посева из стерильной среды в обычную.

Стерилизация раствора для посева семян

Приготовить раствор, разлить по банкам, в которых будут выращиваться орхидеи. Баночки небольшие, лучше пузатые, хорошо помытые. В каждую 40 — 50 мл раствора или примерно 2 см высоты.

Составить банки на противень, герметично закрыть промытыми крышками и поместить в духовку на 20 минут при 150 градусах. Затем духовку выключить, банки не вынимать, пока не остынут. После остывания питательный раствор густеет. Некоторые орхидеисты считают, что подобной обработки недостаточно, чтобы убить бактерии, и стерилизуют банки со средой в скороварке, также около 20 минут, как закипит. После этого пар спускать и вынимать банки.

Инструмент стерилизовать в духовке или скороварке не нужно – не имеет смысла, он потеряет стерильность, когда будете вынимать.

Тут надо заметить, что вы можете проверить любой способ стерилизации без посева семян – оставьте банки пустыми постоять при комнатной температуре 1-2 недели. Если стерильность не достигнута, в них обязательно образуется плесень.

Подготовленная таким образом питательная среда стерильна и может храниться несколько месяцев, в темном прохладном месте. Т.е. до момента пока будет готов посев.

Посев семян орхидей и стерилизация

Для посева нужны чистый стол, инструменты, ультрафиолетовая лампа, приготовленные баночки со средой.

Инструменты: скальпель, свеча или спиртовая горелка, консервный нож (открывать герметичные банки сложно), марлевые салфетки, 70% спирт, чем больше, тем лучше, стеклянные пиалы или чашки (маленький лоток) для плода, замачивания семян, пинцет.

Все манипуляции нужно проводить в комнате, где закрыты окна (не должно быть сквозняка и домашних животных) и комнатных цветов, поэтому удобнее на кухне.

На столе ничего лишнего, только подготовленные банки и инструмент. Лампу можно положить рядом прямо на стол или над столом, например, закрепив её на настольной лампе.

Включаем лампу и оставляем на 1,5-2 часа. Ультрафиолетовое облучение не стерилизует все помещение, а небольшую зону вокруг стола, но убивает большее количество бактерий в комнате. При этом если открывать дверь, когда заходишь в кухню, естественно с потоками воздуха заносятся свежие микробы. Поэтому желательно все посевы проводить максимально быстро и без лишних телодвижений и скачков за забытым инструментом.

Итак, руки протираем спиртом. Все лотки, пинцет, скальпель, крышки банок – все протираем спиртом. Если спирта много, лучше налить в распылитель и периодически сбрызгивать поверхности, ну или протирать салфеткой в спирте, практически каждое действие — положил инструмент, взял — протер. Стол опрыскать или протереть спиртом.

Берем плод и замачиваем минут на 10 минут в спирте (можно в 10 % хлорамине). Вынимаем плод пинцетом, делаем на нем надрез скальпелем, надрез не глубокий, так, что бы плод не треснул, и не раскрылся прямо в руках. Кладем его в стеклянную пиалу.

Включаем спиртовую горелку, в течение примерно 20-30 секунд выдерживаем над ней крышку банки с питательной средой. Равномерно, по всему периметру крышки, сверху и с боков.

Ставим банку, открываем крышку. Крышку на стол не кладем, только приоткрываем, держим в одной руке над банкой (не выше 2 см). Второй рукой берем плод, подносим над банкой и, слегка сжимая средним и большим пальцем, постукиваем указательным пальцем по плоду. Плод обратно в пиалу, банку сразу закрываем. Берем следующую банку и т.д.

Такой метод не требует стерилизации самих семян, но плод должен быть чуточку недозрелым, чуть пожелтевшим (семена созревают раньше самого плода). Если семена не высыпаются, их можно извлечь: мне удобнее использовать инструмент для срезания кутикулы – такая раздвоенная вилочка. Её прополоскать в спирте и обсушить над пламенем горелки, лишь потом вскрывать плод и извлекать семена.

Я не являюсь автором метода, но у меня он получился с первого раза, в то время как посев в боксе из прозрачного пластика и обработанного хлоркой не удался.

Питательная среда такая, рН 4,8 – 5,8:

  • Удобрение «Бона форте» для орхидей 3,3 мл,
  • Сахар 20 г,
  • Агар-агар 15 г,
  • Банановое пюре 50 г,
  • Залить  дистиллированной водой до объема 1 л.

Кислотность среды (pH) для посева эпифитных орхидей должна быть в пределах 4,8 — 5,5. Можно корректировать рН раствора лимонным соком, если pH выше нормы, или питьевой содой, если ниже. Для башмаков кислотность нейтральная рН 7,0. Проверяем лакмусовой бумажкой.

Заканчиваем процедуру посева: баночки плотно закрыты, ставим их на поднос при температуре не выше 25 градусов (не ниже 18), только на рассеянный свет, никакого прямого солнца. Если солнечные окна, то ставим в комнате под люминесцентные лампы. Продолжительность светового дня 12-20 часов. Ждем проростков — они появляются в среднем в течение 2х-4х недель.

В возрасте сеянцев примерно 4-5 месяцев всю процедуру повторить, чтобы рассадить сеянцы более редко, иначе они будут подавлять друг друга, но кроме того, пересадить на более правильный стерильный субстрат. Все компоненты беру, как и предыдущий раствор, только сахарозы в два раза меньше — избыток углеводов тормозит развитие сеянцев. Нужно примерно 10 г сахарозы на 1 л раствора.

Примерно в возрасте 8-10 месяцев, когда у сеянцев уже хорошо заметные корешки и листья, их нужно пересадить. Сами растения промыть от агара в дистилляте, выдержать в растворе антимикотика, например, хиназола, примерно 30 минут.

Готовим субстрат: мох сфагнум порезан ножницами, мелко порубленная сосновая кора, можно добавить пенопластовой крошки. Ставим на 10 мин в духовку, при температуре 200 градусов. Засыпаем субстрат в тепличку (например, пластиковую коробку от торта), пересаживаем сеянцы, ставим на постоянное место. Увлажнение — опрыскиванием дистиллированной водой. Подкормки комплексными удобрениями для орхидей, концентрацией меньше примерно в 10 раз от нормы.

Температура 24-25 градусов, рассеянный свет 12 часов, регулярно проветриваем.

Кстати, впервые ваши орхи, выращенные из семян зацветут лишь через 5-7 лет. Удачи.

Артем Кипелов

Способы размножения орхидей в домашних условиях

Сегодня в продаже можно встретить и доступные, и эксклюзивные орхидеи на любой вкус. Но если купить роскошное растение может каждый, то вырастить орхидею самому — настоящий вызов. Не самое простое в размножении семейство особенных растений не позволяет легко и быстро получить потомство из семян или побегов. Но если есть достаточный опыт, а главное — желание, попробовать стоит. От разделения растущих группой орхидей до очень сложных вариантов с сеянцами — способы размножения любимых орхидей бывают разными — и по доступности, и по времени ожидания результата.

Способы размножения орхидей в домашних условияхСодержание:

Вегетативно или из семян?

Если орхидеи выращиваются в обычных «домашних» или «квартирных» условиях, единственными доступными вариантами получения потомства почти всегда будут вегетативные методы размножения.

Выращивание из семян (даже при достаточном опыте) для орхидей считается сверх сложным. Это уникальные растения, требующие создания стерильной питательной среды, тщательно контролируемых условий и специальных приспособлений. Рядовой цветовод позволить себе такие «игры» не может. Если есть сильное желание и ресурсы — можно попробовать купить готовые сеянцы.

При этом нужно учитывать, что все роскошные и неприхотливые гибриды, которые есть у нас на прилавках — растения, не сохраняющие характеристики при размножении семенами . А видовым орхидеям и редким сортам, которые выращивают из семян, нужны непростой уход и особые условия.

Вид орхидеи всегда диктует способ размножения

Орхидеи — растения поразительно разнообразные. И это касается не только размеров, строения формы листьев, характера роста или особенностей цветения, которые неповторимы не то что у каждого вида, а у каждого сорта. Орхидеи отличаются и индивидуальными особенностями «характера» и возможностей размножения. Для каждой орхидеи есть свои, как правило, крайне ограниченные варианты получения потомства. А часто — и вовсе один доступный для домашних условий способ размножения.

Главным «ориентиром» на доступные методы размножения остается тип орхидей:

  • симподиальные красавицы (онцидиумы, каттлеи, дендробиумы, катасетумы, пафиопедилюмы и др.) размножаются относительно быстро и просто: они растут не по одному растению, а группами, образуют детки и замещающие ростки, и каждая пересадка — это возможность «размножить» коллекцию;
  • моноподиальные орхидеи (ванды и фаленопсисы) — «медленные» в вопросе размножения растения, которые выпускают «детки» поразительно редко.

Но любая орхидея требует терпения и нескольких лет доращивания до цветения. Ведь не случайно считается, что гораздо проще купить орхидеи «готовыми».

Читайте также нашу статью 7 советов по основам ухода за орхидеями для новичка.

Разделение — размножение симподиальных орхидей

Симподиальные орхидеи не размножать не получится. При каждой пересадке пафиопедилумов, каттлей, онцидиумов и Ко они «автоматически» размножаются, ведь группы заполнившие всю емкость, обязательно делят и омолаживают. И частота размножения симподиальных орхидей определяется частотой их пересадки.

Слишком часто, тем более ежегодно беспокоить таких красавиц не стоит, их обильное цветение требует терпения, стабильности и комфорта. Ориентироваться нужно только на потребность орхидеи в пересадке — разрастание, состояние субстрата, а не ваши желания.

Разрезают (пафиопедилум — разделяют вручную) растения аккуратно, на сильные группы с 3 — 4 молодыми псевдобульбами (или точками роста) с листьями. Самые старые и высохшие псевдобульбы обязательно убирают, корни и ростки осматривают, срезы — обрабатывают. Разделение на группы предпочтительно, ведь так быстрее образуются пышные кустики и начнется их цветение. Одиночные ростки часто гибнут, требуют очень тщательного ухода и контроля условий.

При каждой пересадке симподиальные орхидеи «автоматически» размножаются. © missouribotanicalgarden

Укоренение «деток» у орхидей

Дочерние отпрыски у орхидей бывают воздушными (на цветоносах) и прикорневыми. Их отделение — основной способ размножения моноподиальных орхидей, но иногда дочерние отпрыски способны образовываться и на побегах дендробиума. Ванды образуют только прикорневые детки, а вот фаленопсисы — оба типа. У всех орхидей предсказать появление «потомства» почти невозможно.

Даже если придется ждать несколько лет, лучше положиться на природу. На цветоносе дочерние растения, как правило, вырастают при «удачной» комбинации высокой влажности воздуха и достаточно высоких температур. Из спящих прикорневых почек «детки» растут у сильных, здоровых растений — если за ними правильно ухаживают, следят за освещением, поливом, подкормками и предоставляют лучшие условия из возможных.

«Искусственное» ускорение образования отпрысков применяют, но это довольно спорный, пусть и действенный метод стимулирования почек при помощи гормональной пасты с цитокинином. Гормональные препараты невозможно использовать без последствий для материнского растения, да и вмешиваться в природные циклы «самоуправляемых» орхидей достаточно рискованно.

Если есть желание попробовать, пробудить почки достаточно просто:

  1. На растении выбирают одну из спящих верхних почек на цветоносе (или корневище).
  2. Защитную чешуйку аккуратно снимают пинцетом, надрезая по краям острым лезвием, не причиняя травм побегу или почке.
  3. Пасту наносят на почку тонким слоем. Со временем почка набухает и развивается сильная детка.

Воздушные отростки нужно отделять обязательно, прикорневые можно оставлять, выращивая в группе с материнской орхидеей.

Правило отделения и укоренения всех видов деток у орхидей одно: им нужно дать подрасти, выпустить хотя бы 3 листа и образовать собственные корни (в идеале, до 3-5 шт длиной около 5 см, минимум — два полноценных корешка). Процесс этот небыстрый, ведь корни растут очень медленно и неохотно.

Как только детка подрастет, ее можно отделять от материнского растения. Делают это продезинфицированным лезвием, аккуратно, сразу обрабатывая срезы и на материнском растении, и на детке, хорошенько подсушивая ранки.

Дочерние растения высаживают в маленькие емкости, «по размеру», придерживаясь всех правил посадки для конкретного вида. Залог успеха — уход без промахов, качественный субстрат и внимание. Переваливают в емкости побольше молодые орхидеи только по мере потребности, давая им полностью освоить пространство предыдущего горшка.

Почка орхидеи. © BJ

Черенкование у орхидеи

Самую распространенную орхидею фаленопсис при достаточном опыте иногда пробуют вырастить из фрагментов цветоносов. Это редкий, рискованный и не всегда эффективный способ, применяемый в основном для очень ценных или редких сортов.

Пробовать укоренять цветоносы можно после отцветания. Побеги нарезают на черенки длиной около 10 см, с 2-мя или 3-мя спящими почками в каждом. Только верхнюю почку можно оставлять одну. Срезы должны быть ровными и аккуратными. Их присыпают углем и подсушивают от 2-х до 12-ти часов.

Укореняют черенки орхидей не совсем стандартно:

  • неглубокие контейнеры заполняют продезинфицированным субстратом — мелкой корой, сфагнумом, перлитом, песком, вермикулитом, равномерно его увлажняя;
  • подготовленные черенки укладывают на почву горизонтально, на расстоянии, так, чтобы ветки не касались друг друга и почки не контактировали с субстратом;
  • емкость накрывают стеклом или затягивают пленкой, создавая условия закрытой теплицы со 100%-ой влажностью.

Поддерживая влажность почвы стабильно высокой, своевременно убирая конденсат с укрытия и ежедневно проветривая «парничок», черенки содержат на нижнем подогреве или в череночнике, при температуре в 25-29 градусов, отслеживая набухание почек. Если признаков просыпания нет, дольше нескольких месяцев ждать не стоит. Если какая-то из почек проснулась, сохранять тепличные условия для черенков нужно не просто до начала роста, а до достаточного наращивания корней — до длины в 3-5 см. К обычному воздуху растения приучают постепенно.

Черенкование у орхидеи. © flor-amore

Выращивание сеянцев орхидей

Некоторые орхидеи попадают к коллекционерам именно как сеянцы — в колбе или фласке. Встретить такие емкости можно и во время путешествий, и в клубах, и на форумах. В одной емкости в стерильной среде растут от 10 до 25 растений, обычно редких сортов и разновидностей с непредсказуемыми характеристиками. Такие орхидеи требуют очень долгого доращивания до цветения и часто не выживают.

Вынимать орхидеи со стерильной среды лучше только тогда, когда сеянцам станет тесно в колбе или фласке:

  1. Колбу разбивают, аккуратно вынимая очень хрупкие растения, промывая их в чистой воде или в слабом растворе марганцовки, а затем обсушивают на мягком полотенце.
  2. Посадку проводят в общий контейнер или отдельные прозрачные стаканчики, в сфагнум или смесь сфагнума, мелкой коры и перлита, отслеживая, чтобы точка роста и листья остались на поверхности.

Сеянцы орхидей нужно содержать в минитепличках, цветочных витринах, закрытых прозрачных контейнерах при 100% влажности воздуха, стараясь поддерживать стерильность. Искусственная досветка, температура от 20 до 24 градусов обязательны еще долгие годы.

Сеянцы постепенно переваливают по мере роста и очень медленно приучают к нетипичной среде, год за годом немного понижая влажность воздуха. Без увлажнителей, идеального ухода с поливами по мере подсыхания субстрата и малоконцентрированных, но частых комплексных подкормок (стандартных и внекорневых) успеха не добиться.

Сеянцы орхидей

Размножение орхидей переукоренением верхушки

Старые, вытянувшиеся, «заваливающиеся» фаленопсисы с большой массой воздушных корней можно омолаживать переукоренением. Сильную, с несколькими парами листьев и многочисленными воздушными корнями верхушку срезают со старого «основания» и высаживают как самостоятельное растение. А «пенек» оставляют, дожидаясь, пока из него не начнут расти прикорневые детки.

Читайте также нашу статью Как поливать орхидею в домашних условиях?

Варианты размножения гибнущих орхидей

Фаленопсисы, сильно пострадавшие от гнилей, солнечных ожогов, переохлаждения, неправильного ухода часто выпускают в «отчаянии» прикорневую детку. А иногда новый росток появляется уже на, казалось бы, полностью погибшем, засохшем растении. Выбрасывать «пеньки» и безлистные корни сразу не стоит, давая растению шанс родить потомство.

Если орхидея гибнет от гнили, но еще сохраняет здоровые листья, их можно попробовать укоренить, аккуратно отламывая с «шейкой». В тепличке, если при помощи подпорок разместить лист над водой или влажным субстратом, сохраняется шанс, что у основания со временем разовьются новые корешки и листья.

Размножение орхидеи в домашних условиях

Как правильно размножить орхидею?


Зная определенные особенности разведения орхидей в домашних условиях, можно смело размножить полюбившийся экземпляр. Размножение орхидеи производят делением крупных растений, детками, верхушечными черенками, боковыми побегами, отводками, псевдобульбами, семенами.

Лучшим временем года для размножения является начало весны (при пересадке), когда растение орхидеи вот-вот должно выйти из состояния покоя, имея достаточно сил для роста…

Основные способы при размножении орхидеи.

  • Вегетативное размножение — используют части материнского растения (черенки, старые псевдобульбы, боковые побеги, детки, отводки…), носит название бесполый. Орхидеи в этом случае получаются генетически равные материнскому растению.
  • Генеративное (семенное) размножение — этот способ называется половой. Иногда при таком выращивании возникают орхидеи, совсем непохожие на родительские растения.
  • Меристемное размножение (клонирование)
  • Селекция орхидей

Чаще всего домашние орхидеи размножают простым делением куста во время пересадки, просто разъединив куст по частям с корнями, но при этом на каждой из частей желательно оставить по три ростка (см. деление)… Для размножения черенками используют старые удлиненные, отцветшие стебли, боковые побеги или фрагменты псевдобульб (о черенковании см. ниже)… Иногда используются детки, образующиеся из верхних узлов псевдобульб или почек на цветоносах…

При любом размножении, либо делении орхидей, а также при уходе важно соблюдать некоторые правила. Необходимо работать только с продезинфицированными инструментами. Для корней требуется осторожное обращение, так как они легко ломаются. Места всех срезов присыпать толченым древесным углем. Перед посадкой свежий субстрат для укоренения нужно хорошо смочить мягкой водой. На 3-4 недели растения следует поставить в теплое место, но не солнечное. Не поливать, а только опрыскивать один раз за день, не подкармливать удобрениями…

см. «Как ухаживать за орхидеями?»

Размножение орхидеи стеблевыми отпрысками (детками)


«Детки», «боковые побеги» представляют собой маленькие новые растения, которые способны образовывать определенные сорта орхидей. К ним можно отнести, например, Фаленопсис (Phalaenopsis), Дендробиум (Dendrobium). «Боковые побеги» могут появиться, если дома, там где находятся растения, достаточно высокая температура воздуха. Также их возникновению способствует внесение удобрений, у которых повышено содержание азота.

При появлении «деток» необходимо очень часто опрыскивать его, дожидаясь, когда они достаточно сильно подрастут и пустят корни. После этого новое растение надо будет отделить, обработать срез порошком древесного угля, посадив отдельно.

Отводки у симподиальных орхидей

Отдельные домашние виды орхидей размножают отводкой длинного безлистного стебля в соседний горшок на сфагновый мох, чтобы ускорить пробуждение почки, либо «взросление» детки, как сказано выше. Воздушные отпрыски часто образуются у побегов, которые имеют утолщенные цилиндрические или удлиненные веретеновидные побеги. Например, некоторые виды Дендробиумов (Dendrobium), Эпидендрумов (Epidendrum). Потребуется маленькая тепличка над пригнутой частью стебля из перевернутой пластиковой емкости, проделав сбоку прорезь. Увлажняя мох, придется терпеливо дожидаться пробуждения спящих почек.

Для того, чтобы ускорить формирование воздушного побега, безлистный побег уложенный горизонтально, держат в тепличке, которую нужно обогревать, регулярно увлажнять. Через несколько недель спящие почки пробуждаются, приблизительно через месяц. Из них вскоре вырастают молодые орхидеи с корнями и листьями. После укоренения новые маленькие растеньица нужно осторожно отделить от материнского побега, обработать, затем посадить в маленький горшок. Некоторое время подросшие орхидеи следует держать в этой же тепличке, не забывая про уход.

Еще одно важное условие при разведении орхидей — хорошее освещение. Если света недостаточно, надо будет обеспечить искусственную подсветку, иначе пробуждения почек можно ждать очень долго, либо вообще не дождаться.

«Фотоурок по размножению дендробиума детками»

Вегетативное размножение орхидей (деление)

Деление орхидеи является самым простым, доступным способом размножения орхидеи в домашних условиях, который подходит для большинства групп. Таким методом удобно размножить симподиально растущие орхидеи (Каттлея (Cattleya), Цимбидиум (Cymbidium), Пафиопедилум (Paphiopedilum) и т.д.). Корневище таких растений необходимо просто разделить (оставляя каждой деленке по 2-3 псевдобульбы). Важное условие для этого вида размножения — растение должно быть достаточно большим.


Растение вынимают из горшка, осторожно отделяют субстрат от корней. С помощью садовых ножниц (секатора) или ножа корневище разрезают насквозь, оставляя на каждой разделенной части по две-три бульбы. Срезы присыпать порошком древесного угля, чтобы избежать заболеваний. Посадить отдельно каждый фрагмент. Поливать слегка, ежедневно опрыскивая растение до появления новых листьев или побегов, в подтверждении, что растение принялось.

Делить растения на более мелкие части нежелательно, из-за чего потом придется долго ждать, пока вырастут из них полноценные, жизнеспособные экземпляры. При соблюдении всех условий домашняя орхидея, размноженная таким способом, может зацвести в этом же сезоне.

Орхидеи делят во время пересадки, если например, им стало тесно, а псевдобульбы стали вылезать из земли. Можно у отцветших орхидей отделить старую бульбу, посадив отдельно, при этом поддерживая влажный воздух, соблюдая температуру 20 градусов. Отделенную псевдобульбу просто укладывают на поверхность. Горшок должен быть заполнен влажным сфагнумом или орхидейным субстратом. Через определенное время из почек у основания бульбы появятся молодые растения с собственными корнями, которые следует отделить, рассадив по горшочкам. Орхидеи вида Онцидиум (Oncidium), Цимбидиум (Cymbidium) идеально размножаются именно этим методом.

К сожалению, разделить куст на равноценные части почти невозможно, так как имеющие на концах молодые псевдобульбы с хорошо развитой почкой, будут всегда сильнее тех, которые располагают лишь старыми бульбами. Это объясняется только тем, что у молодой бульбы из почки в дальнейшем сможет развиться полноценный побег. Побеги на старых бульбах образуются из более мелких спящих почек, поэтому приросты у них слабее и потребуется для них более продолжительное время.


Мощное растение подготовливают к делению заблаговременно. Чтобы простимулировать на старых бульбах развитие придаточных почек, за год до посадки необходимо надрезать ножом корневище в определенных местах до середины. Это позволит при пересадке получить несколько полноценных частей (деленок).

Части с 3-4 бульбами, заканчивающиеся молодой псевдобульбой, содержат так же, как взрослые растения. При делении они лишены своей части корневой системы, поэтому до начала роста их чаще опрыскивают, поддерживают повышенную влажность, используя тепличку. Слабые деленки содержат при повышенной влажности в полиэтиленовом пакете, либо небольшом изоляторе. Следует насыпать слой чистого мха-сфагнума.

После появления молодых корней, деленки пересаживают на постоянное место, продолжая ухаживать за ними. Таким же образом можно разделить орхидеи-башмачки и другие розеточные симподиальные виды. Нельзя допускать пересыхания субстрата. Из-за недостатка влаги розетки сильно истощаются, быстро теряют нижние листья, отчего могут погибнуть, не успев образовать новые побеги.

В отдельных случаях применяют черенкование…

Есть и более сложные способы размножения — черенками фрагментов псевдобульб в песке в теплом месте (не ниже 25 градусов, верхушечными побегами, образующими воздушные корни — такие черенки можно заготовлять ежегодно.

Этим способом довольно быстро размножают некоторые виды орхидей, у которых псевдобульбы образованы в результате утолщения нескольких междоузлий стебля. Этот вид черенкования позволит реализовать почти весь запас имеющихся почек на бульбе и получить за один год большое количество растений.

Для получения черенков взять хорошо вызревшие 2-3-летние бульбы. Отделив их от растения, разрезать кусками таким образом, чтобы каждый отрезок имел хотя бы свой узел с хорошо развитой почкой. Срезы присыпать толченым углем, после 2 дней подсушивания черенки поместить во влажный (лучше живой) сфагнум. Содержат их на рассеянном свету, соблюдая температуру не ниже 20 градусов, при высокой влажности воздуха, небольшом изоляторе или просто полиэтиленовом пакете. Чтобы черенки не загнивали, их надо регулярно проветривать. В этих условиях спящие почки через 1-2 месяца начнут развиваться, превратясь в небольшие растения.

Размножение верхушечными черенками (боковыми побегами)…


Размножать верхушечными черенками можно некоторые виды моноподиальных орхидей, у которых между узлами побегов четкие расстояния. Таким методом отлично размножаются орхидеи вида Ванда (Vanda), Дендробиум (Dendrobium), Эпидендрум (Epidendrum).

Для размножения черенками (например, фаленопсис) берут боковые побеги, старые удлиненные или отцветшие цветочные стебли, около 10-15 см длиной. Срезанный черенок кладут плашмя на поверхность почвы (мха сфагнума или песка), помещают его в тепличку, желательно с подогревом. При появлении корней черенок орхидеи сажают.

Размножение цветоносами производят не только фаленопсисов, но также других групп орхидей. Достаточно разрезать цветонос небольшими отрезками, состоящие из 1-2 узлов, затем поместить их во влажный мох, чтобы через месяц из спящих почек стали развиваться молодые растения.

Размножая орхидеи черенками или цветоносом, должны помнить о том, что пазушные почки, расположенные на стебле — неравноценны: чем ниже почка — тем она сильнее.

Моноподиальные виды делят, отрезав верхнюю (молодую) часть стебля (на половинной высоте) с несколькими воздушными корнями, обработав место среза древесным углем. Сажают их в субстрат, содержат так же, как взрослое растение. Таким же способом можно размножать быстрорастущие виды. Другие виды могут зацвести только через несколько лет.

Оставшийся от стебля «пенек» переставить в более влажное место, следует чаще опрыскивать. Из субстрата вынимать растение нет необходимости. При таком уходе, спустя некоторое время, от имеющихся на стебле придаточных почек разовьются боковые побеги, которые легко отделить после появления их собственных корней. Деленки регулярно опрыскивают, пока их собственные корни как следует не закрепятся в субстрате. При размножении моноподиальных орхидей (в частности ванд) пазушные почки иногда обрабатывают растворами цитокининов (кинетина). С растения удалить несколько нижних листьев, оголившийся стебель со спящими почками опрыскать подготовленным раствором концентрации 750 мг/л. Проделывают это дважды в течение 5-10 дней. После такой обработки растение образует несколько боковых побегов, их также можно отделить.

Семенное размножение орхидеи.

Орхидеи имеют очень маленькие семена, в которых отсутствует питательная ткань. Внешне они напоминают мелкую пыль. В природе семенам помогает расти специальный грибокорень микоризы или корневая губка, которая снабжает семя всеми необходимыми ему питательными веществами.

Размножая орхидею подобным образом, необходимо поместить семена в искусственную питательную среду, как уже сказано. Процесс этот должен происходить абсолютно стерильно, которых можно добиться только лабораторным путем. Семя здесь прорастает 3-9 месяцев, после чего получается росток. Чтобы он превратился в растение, готовое к посадке, нужно подождать ещё 1,5-3 года. А увидеть долгожданное цветение этого растения можно лишь спустя 2-4 года. Некоторые виды орхидей, например, Пафиопедилум (Paphiopedilum), который имеет второе название — венерин башмачок, иногда впервые зацветают лишь через 10 лет.

Ну а если кто-нибудь хочет попробовать вырастить орхидеи из семян, то для начала необходимо подготовить почву, состав которого рубленый мох, с добавлением туда немного листовой земли; хорошенько увлажнить. Семена высеивают рядами, не присыпая почвой сверху. Нужно поддерживать стерильные тепличные условия, идеальную температуру, которая должна составлять 22-25 градусов, при высокой влажности воздуха. Семена не нужно поливать, их достаточно просто опрыскивать мягкой теплой водой. После появления всходов, а затем первого листика, их пикируют, подобрав правильно почву, составленную из равных частей мха и торфа. Вторую пикировку проводят после появления второго листика, при этом почва пополняется рублеными корнями папоротников, кроме мха и торфа. Как только образовалось четыре листика, сеянцы пикируют в постоянные горшки. Цветы можно будет увидеть лишь через несколько лет.

Меристемное размножение (клонирование).

Существует еще меристемное размножение орхидеи — см. «Микроразмножение». С помощью микроскопа из точки роста материнского растения извлекают клетки, способные делиться. Они носят название меристематические клетки. Их помещают в питательную среду, где они продолжают делиться. Затем из клеток образуются сгустки. Их разделяют, после чего помещают в другую среду, где со временем образуются растения. Все манипуляции этого способа необходимо проводить исключительно стерильно. Этот научный метод размножения орхидеи является наиболее сложным, но у него есть большое преимущество перед остальными способами: за очень короткое время можно получить огромное количество генетически одинаковых растений…

Выращивание сеянцев орхидеи.

Помимо вегетативного приема выращивания, существует еще генеративное (половое) размножение. На данный момент многие фирмы занимаются выращиванием орхидей промышленно. Сложный процесс размножения и проращивания цветов в искусственных питательных средах у них хорошо отлажен.

Семена орхидей попадают в эту питательную среду, в основном, двумя способами. Первый — лабораторным способом, распространён промышленно развитых странах, когда семена собираются в оранжереях. Второй способ практикуется такими странами, как Индия, Юго-Восточная Азия: собранные в джунглях семена, помещаются в питательную среду, где обычно с успехом прорастают.

В домашних условиях также можно попробовать размножение орхидей половым путем, хотя является наиболее длительным и сложным, чем бесполые способы. Но есть надежный способ попытаться вырастить пророщенные сеянцы, которые можно приобрести у различных фирм, специалицированных магазинах.

Чаще всего, у многих нет возможности выращивать орхидеи семенами. Сеянец, пока ещё вырастет, зацветёт! Долгое время его нельзя оставлять без присмотра: постоянно нужно помнить про свет, температуру, влажность, наблюдать, как он растет, что нравится ему, что — нет. Нужно пытаться адаптировать сеянец орхидеи под свои домашние условия, определять оптимальный, именно для него подходящий режим.

Ёмкости для проращивания семян могут быть различными, начиная от обычной бутылки, заканчивая специальной стеклянной колбой, как правило, герметично закрыты. Если выбирать сеянцы в их стеклянных и пластиковых сосудах, то лучшим вариантом является тот, когда растения плотно «сидят» в ёмкости — при её переворачивании не смещаются, не гнутся, не ломаются. Если сеянцы в бутылке свободно перемещаются, то каждый загиб листочка чреват возникновением у растений болезней, различных гнилей.

Вне всякого сомнения, размножение орхидей очень интересно само по себе, хотя потребует определенных знаний, времени, внимания. Получив должный уход, растение зацветет и станет всеобщим центром внимания, что невольно подтолкнет любителя к новым испытаниям по выращиванию этих прекрасных цветов.

Извлечение из фласков (флаконов, колб), приучение к «нормальной» жизни сеянцев…
«Как извлечь сеянцы орхидей из флаконов? «

Понравилась информация? Поделитесь ей с друзьями!

загрузка…

И не забывайте про наш форум-сообщество! Вступайте в ряды цветоводов и любителей растений!;)

возможность размножать некоторые виды орхидей индивидуально

Эти тропические красавицы встречаются практически в каждой семье.

Обворожительность и привлекательность цветка притягивает взгляды многих людей. Со временем возникает уместный вопрос о том, как размножить орхидею в домашних условиях самостоятельно? Что для этого надо, насколько это сложно и какие необходимо иметь для этого знания?

Можно сразу успокоиться: такая задача под силу даже начинающему цветоводу. Самый важный фактор – наличие желания. Необходимую информацию можно получить из этой статьи.

Конечно, придётся получить определённые знания:

  1. Общая информация о цветке.
  2. Несколько способов размножения орхидеи в домашних условиях.
  3. Какой вид растения у вас.
  4. Возможные особенности размножения орхидеи.

Орхидея, кто она

Орхидные (Orchidaceae лат.) – древнейшее семейство. На всех континентах можно найти их представителей. Это может быть: многолетняя трава с развитой корневой системой или тропический эпифит, который использует ствол другого растения как свою опору.

Орхидеи могут радовать цветовода не один десяток лет, если живут в хорошо созданных искусственных условиях. Из этих цветов делают крахмал, ваниль и даже лекарства. Они отлично приспособились к жизни, вступают в симбиоз с другими растениями с целью получения воды и других питательных элементов.

Система размножения

Естественный путь размножения у орхидей – семенами. Чтобы размножиться, цветок выделяет примерно четыре миллиона семян, у которых отсутствует запас питательных элементов. Семена должны найти себе носителя, определённый вид гриба, обладающий специализированным субстратом.

Этот способ применяют специализированные предприятия, для разведения в больших количествах. Дело, требующее знаний и условий, довольно трудоёмкое и сложное.

Любители пользуются вегетативным способом, используя для размножения различные части растения. Это просто и доступно любому цветоводу. Самостоятельно размножать орхидею можно несколькими способами используя:

  • деток;
  • отводки;
  • черенки;
  • проводя деление от корня.

Некоторые распространённые комнатные орхидеи

Эти домашние цветы отличаются огромным разнообразием. Различные формы, удивительное разнообразие цвета и рисунка цветка привлекает к себе внимание и радует взгляд. Они украшают различные дома, и позволяют обладателям гордиться своими коллекциями.

Дендробиум (лат. Dendrobium) – растения, растущие в тропиках на деревьях. Название на латинском языке точно описывает цветок: dendron — дерево, bios — жизнь, или живущие на деревьях.

Очень простой и неприхотливый цветок, который можно найти в любой любительской коллекции.

Ванда (лат. Vanda) – нежные цветы, чувствительные к температурным колебаниям и освещению. Обращают на себя внимание синим или голубым цветком, а также необычной формой листьев.

Каттлея (лат. Cattleya) – многообразная расцветка и неповторимая красота цветка, завоевала многих любителей орхидей.

Фаленопсис (лат. Phalaenopsis) – цветки большого размера, как нежные порхающие бабочки.

Аскоценда (лат. Ascocenda) – это гибрид орхидеи Аскоцентрум и Ванда. Очаровательное растение, удивляет своей красотой. Их содержат, несмотря на сложности выращивания. Им нравится свет, тепло и большая влажность, всё, что присуще тропикам.

Орхидеи можно поделить на две особенности роста:

Симподиальные – те, что развиваются горизонтально. У них насчитывается несколько псевдобульб, единая корневая система, имеющая несколько точек роста. Их ещё называют как надземные или воздушные клубни, ложные луковицы и туберидий.

Моноподиальные – такие цветы имеют только одну точку роста и один стебель, растущий вертикально.

Как размножить орхидею в домашних условиях

Правильное размножение орхидей требует выполнения нескольких обязательных условий:

  • Берут только здоровое и незараженное растение.
  • Самое подходящее время для размножения – выход растения из покоя, это 30–60 дней после цветения.
  • Рабочий инструмент всегда чистый и дезинфицированный.
  • Пользуются скальпелем или лезвием для бритья, острый инструмент позволяет сделать аккуратный срез.
  • Для дезинфекции срезов используют измельчённый активированный уголь, дают краям подсохнуть.
  • Молодое растение требует умеренного опрыскивания и тёплой температуры в помещении.

Размножение орхидей

Симподиальный тип роста

Корневая система таких растений, постепенно занимает всю площадь горшка, в котором растёт. Делить такой цветок рекомендуют перед началом активного роста, конец февраля или начало марта.

Растение готовым к размножению считается в том случае, если оно имеет хорошо развитые псевдобульбы и их больше шести. Специалисты советуют подготавливать цветок за год до операции. Если заранее сделать небольшие надрезы у корней, на местах будущих расчленений, можно простимулировать появление придаточных почек.

Весь процесс размножения орхидей можно разделить на несколько шагов:

  • аккуратно вынимаем из горшка;
  • желательно очистить корни от субстрата;
  • разделяем корни, оставляя на каждом отводке две-три псевдобульбы;
  • проводим дезинфекцию, применяя активированный уголь;
  • части с молодыми корнями высаживаем в готовый субстрат;
  • старую часть растения или слабую помещают в полиэтиленовый пакет с торфяным мхом (сфагнум). Тепло и влага будут способствовать образованию новых молодых корней.

Такое вегетативное размножение используют, выращивая дендробиумы, каттлеи, цимбидиумы. Один куст делить можно раз в пять лет, чаще это делать не рекомендуют.

У дендробиумов псевдобульба формируется на стебле, в виде утолщения. Кроме деления корня, можно применять ещё один метод размножения орхидей, черенковый.

  • скальпелем отделяем побег от материнского растения;
  • делим побег на черенки, каждый черенок должна иметь сформированную почку;
  • используя активированный уголь, проводим дезинфекцию;
  • через пару дней, когда подсохнут срезы, помещаем черенки в пакет с влажным торфяным мхом;
  • условия содержания: температура 20 °С, рассеянный свет, отсутствие прямого солнечного света, постоянно влажный мох;
  • регулярно проветривая, предотвращаем загнивание черенков;
  • хорошие условия содержания пробуждают спящие почки, через один-два месяца появятся молодые ростки;
  • молодой цветок готов к высадке, если есть два-три полноценных листа и корней, который больше четырёх сантиметров длиной.

Простой домашний способ размножать цветок, но цвести он начнёт не раньше двухлетнего возраста.

Моноподиальный тип роста

У орхидеи этого типа одна точка роста, из-за этого используют побеги верхушки или отработавший цветонос.

Использование верхушечных побегов

Применять этот способ размножения, лучше на быстрорастущих видах орхидей. Таким образом, можно корректировать размер растения и увеличить количество цветов. Такие орхидеи, после пересадки, быстро восстанавливаются и начинают цвести.

Для размножения:

  • отрезается молодая часть стебля, на которой отросли сильные воздушные корни;
  • срез дезинфицируют, применяя измельчённый активированный уголь;
  • материнское растение отгораживают от прямых лучей света и регулярно опрыскивают, пока не появятся новые побеги;
  • черенок устанавливают в субстрат, но не углубляют, он быстро разовьёт собственные корни;
  • опрыскивают регулярно, каждые пять–шесть дней.

Размножение побегами цветков

Довольно практичный метод для разведения фаленопсиса. Используя отцвётшие цветочные побеги, невозможно повредить растению. Берут зелёный и крепкий побег цветка:

  • Срезают черенок, с имеющимися на нём одним или двумя спящими почками;
  • присыпают срезы перемолотым активированным углем и подсушивают;
  • размещают отрезанный черенок на торфяной мох;
  • важно создать тёплую и влажную атмосферу, расположив черенок в тепличке или полиэтиленовом кульке. Это простимулирует развитие корнем и развитие спящих почек.

Нижняя часть цветка и спящие почки, расположенные на ней, в качестве черенка для размножения считаются самыми сильными.

Размножение орхидей детками

Новый отросток, развивающийся на цветоносе, в основании листа или из спящей почки, называется – детка. Есть определённый вид орхидей, обладающих подобным свойством.

Можно простимулировать появление деток избыточно влажной средой, повысив температуру в помещении, или перекормив азотным удобрением. Даже погибающее растение, в таких условиях, способно вырастить прикорневую детку.

Этот вид размножения отлично подходит для фаленопсиса и дендробиум монилиформе. Эти орхидеи обрастают детками произвольно, в таких условиях может работать даже начинающий цветовод.

Детки фаленопсиса

Стадия покоя, после цветения, самое подходящее время для размножения. Берут цветонос фаленопсиса, не старше полтора года. Проделывать операцию идеально в конце зимы, хорошо через два месяца после того, как цветение закончилось.

Обрезается крайняя часть отцвётшего цветоноса до последней спящей почки. Срез обрабатывают активированным углем. Теперь необходимо создать условие для появления и развития детки. Для этого:

  • сокращают полив растения до одного раза в две недели;
  • обеспечивают растение температурным перепадом;
  • ночная температура не выше 18 °С, дневная не ниже 25 °C;
  • необходимо обеспечить воздействием прямых солнечных лучей, западное окно отлично подходит для этого, несколько часов солнца в день;
  • с началом образования деток на побегах, растение убирается в тень, начинается время интенсивного подкармливания, наружным опрыскиванием;
  • готовым к отделению считается детка, у которой отросли корни на 3–4 см;
  • его отделяют и пересаживают в горшок с сосновой корой, которую используют в качестве субстрата.

Хорошие условия для роста молодой орхидеи – тепличные. Растение считается взрослым, когда корешки вырастут до дна горшочка.

Детки на цветочном стебле

Орхидея может самостоятельно вырастить детку на стебле цветка. Это происходит, когда нарушается благоприятный для цветения микроклимат или скудный полив, а также к этому может привести нестабильная температура и избыток питания.

Однако можно и не ожидать чуда, а вырастить детку самостоятельно, воспользовавшись специальными стимуляторами роста.

Для начала, выберите спящую почку на стебле отцвётшего побега, это и будет детка. Очень осторожно, пинцетом, надо снять с неё покровную чешуйку и нанести стимулирующую рост цитокининовую пасту.

Дальше проще, создаём условия микроклимата: температура 25 °C, отсутствие прямых солнечных лучей, умеренная влажность и азотистое удобрение. Детка начнёт развиваться и вырастит через шесть–двенадцать месяцев.

Отделять детку можно, когда у неё вырастит два — три листика и корни, которые должны достигнуть длины более трёх сантиметров.

Есть вероятность, что выбранная вами спящая почка, вырастит не деткой, а новым цветоносом. Об этом вы узнаете только через один–два месяца.

Детки дендробиума

Этот вид орхидеи способен выращивать деток самостоятельно, на псевдобульбах. Перед их отделением стоит подождать, пока корни вырастут на пять — шесть сантиметров. Затем:

  • скальпелем подрезаем необходимые ткани, аккуратно проворачивая детку;
  • места срезов дезинфицируем при помощи активированного угля;
  • подготавливаем прозрачный горшок, в нём дренаж, из измельчённой пробки или пенопласта;
  • свободное пространство, после помещения молодой орхидеи, заполняем, используя увлажнённый торфяной мох;
  • фиксируем ростки, придав им вертикальное положение тонкими палочками;
  • умеренная влажность и тень обезопасят растение от застоялой воды и пересыхания;
  • только через три–четыре месяца, после появления новых ростков и развитой корневой системы, можно пересаживать растение на постоянное место.

Пройдёт два года и молодая детка дендробиума начнёт своё первое цветение.

Размножение орхидей отводками

Отводки делают из достаточно мягких и гибких стеблей некоторых видов орхидей. Псевдобульба, образовавшаяся на междоузлие орхидеи с симподиальным типом роста, подходит для этой цели лучше всего.

Для этого:

  • выбираем взрослую и здоровую орхидею, которая находится на этапе пробуждении;
  • заранее подготавливаем прозрачный горшок, наполнив его торфяным мхом;
  • пригибаем стебель и спящую почку размещаем в центре горшочка;
  • накрыв пластиковым стаканом, делаем теплицу. Для свободной части стебля необходимо прорезать отверстие на кромке стаканчика;
  • важно поддерживать умеренную влажность. Мох должен быть влажным, но не мокрым;
  • для пробуждения спящей почки, необходим четырнадцати часовой световой день. Его необходимо создать, вплоть до искусственного освещения;
  • появления маленького растения на отводке является сигналом, его отделяют от материнского растения и пересаживают.

Запомните: создав необходимые благоприятные условия, можно ожидать активизации спящих почек через 15–21 день.

Размножение орхидеи в домашних условиях

Начинающие цветоводы часто с опаской заводят себе орхидею и слабо представляют, как ее размножить в домашних условиях. Есть устоявшийся стереотип о том, что размножение орхидных сложный и кропотливый процесс, однако, это не совсем так. В любом случае, владельцу орхидеи придется размножать растение, чтобы сохранить его здоровье и простимулировать рост. Тем более, что для размножения не требуется особых навыков, нужно лишь изучить основные принципы, особенности ухода, учитывать режим полива и условия содержания.

Условия для размножения орхидеи

Орхидея родом из жарких тропиков, поэтому подходить к уходу за ней следует соответствующе. В дикой природе орхидеи растут прямо на деревьях, не паразитируя на стволе. Растение выживает благодаря своей корневой системе, которая впитывает влагу с опоры. Корни вида покрыты специальной пленкой, они довольно большие, но одновременно хрупкие. Листья также являются важной частью жизнеобеспечения орхидеи, поэтому полив обычно делится на корневой и внекорневой. Для правильного размножения учитывайте несколько факторов: Время — цветок лучше размножать весной или в конце фазы обильного цветения. Не стоит заниматься размножением в период цветения или зимой. Весной орхидея выходит из периода покоя, легко адаптируется и стрессоустойчива. Температура — орхидея — тропический житель, поэтому +29 градусов считается хорошей отметкой, чтобы попробовать размножить орхидных. Влажность — средняя влажность воздуха не должна превышать 50-70%. Все, что выше, уже может негативно сказаться на процессе роста. Возраст и состояние растения — к размножению годятся только взрослые особи (от 2 лет). При этом они должны быть здоровыми, крепкими и не подверженными болезням. Если у орхидеи желтеют листья, появляется слизь или вредители, размножать растение нельзя.

Способы размножения орхидеи

Орхидеи — это одно из самых популярных домашних растений, но многие цветоводы просто не знают, как правильно заниматься размножением орхидных. Долгое время считалось, что некоторые способы просто невозможны, например, размножение семенами. Стоит отметить, что орхидеи в домашних условиях размножаются также, как и в дикой природе. Существует 5 различных способов размножения орхидей (вегетативное, черенками, семенами, цветоносом и детками). Перед тем как начать размножение, сперва стоит узнать сорт и вид вашей тропической красавицы. Все орхидеи делятся на два вида — моноподиальные и симподиальные. Размножаются орхидеи в зависимости от видовой принадлежности. Во время обрезки и деления не забывайте о важном нюансе. У орхидей есть воздушные корни, которые очень важны на всех этапах развития.

Вегетативное размножение

Распространенный способ размножения для большого количества комнатных растений. Если цветку в горшке стало слишком тесно или на корнях образовалось большое количество псевдобульб, необходимо обрезать часть растения и пересадить в другой горшок. Хорошо полейте цветок и освободите корни от земли. Затем разрежьте корни на несколько частей, чтобы на каждом оставалось не менее 3 луковиц. Присыпьте место надреза угольным порошком, чтобы не занести инфекцию, 2-3 часа дайте саженцам просохнуть и пересадите их в подготовленную емкость. Первые 3 дня не поливайте орхидею, а только опрыскивайте листья. После вегетативного размножения новое растение сохраняет все признаки материнской орхидеи и хорошо укореняется.

Размножение черенками

Способ, который подходит далеко не всем сортам орхидей. Чтобы получить черенки, необходимо использовать боковые побеги. Выбранный черенок нарежьте ножом на несколько частей. Присыпьте материнское растение и места надреза у черенков углем или другим антисептиком. Хорошо просушите отросток и положите во влажный грунт. Черенки нужно поместить в парниковые условия (температура не ниже +28) и накрыть крышкой или полиэтиленовой пленкой. Через день поливайте черенок отстоянной водой, а раз в 10 дней можно подкормить растение. Из почек разовьются корешки, а как только они достигнут 4 см в длину, их можно высаживать в горшок.

Размножение цветоносом

Размножение цветоносом редко применяется на практике и больше подходит для больных растений. Для этого способа нужен отцветший цветонос с увядшим бутоном. Цветонос разрезается на 2 части так, чтобы было по одной почке на каждой. По итогу дальше нужно будет повторить те же действия, что и в случае размножения черенками, но можно сделать и по-другому. Полученные части цветоноса помещаются в бутылку с отстоянной водой, в которую добавляется активированный уголь (для стимуляции роста). Жидкость в бутылке меняется не реже одного раза в неделю, а температура должна быть приближена к парниковой. Разбудить почку можно при помощи цитокининовой мази. Для этого на почке требуется сделать небольшой надрез и аккуратно втереть в это место мазь. Детка будет готова к пересадке после появления трех листьев и небольших (до 6 см) корней. После этого детку перемещают в прозрачный горшок с древесной корой. Обратите внимание, что орхидее необходим рассеянный свет, а прозрачный горшок нужен для попадания лучей на корневую систему.

Размножение детками

На цветоносе у большинства орхидей есть почки, из которых могут развиться детки. Они уже готовы к пересадке и могут появиться самостоятельно, однако в некоторых случаях нужно будет провести стимуляцию почки. Стимулировать лучше в конце января, когда цветок уже отцвел. Для этого сократите полив и прекратите подкармливать растение. Вечерняя температура должна быть +27 градусов, а ночная +16. Если вы все сделаете правильно, уже через месяц почка начнет просыпаться. Сразу после первых признаков пробуждения следует возобновить регулярный полив и вновь удобрять орхидею. Не торопитесь пересаживать деток в отдельный горшок и дождитесь формирования крепкой корневой системы. Это не быстрый процесс, который обычно занимает до 8 месяцев. За это время на отростке обычно успевают появиться 4 листа и несколько собственных корешков. По прошествии необходимого времени, срежьте проклюнувшийся побег ножом и обработайте антисептиком или углем места среза. Через 2-3 часа побеги можно высадить в увлажненный субстрат. Накройте росток пластиковым стаканом, чтобы создать мини-парилку. Увлажнять почву необходимо раз в 2-3 дня, время от времени давая ростку “подышать”. Если все в порядке, листья зеленеют и растут, крышку можно снимать.

Размножение семенами

Это самый длительный и трудоемкий способ размножения, который не пользуется большой популярностью у цветоводов. Помимо очевидных сложностей, орхидея выращенная из семян часто не имеет схожести с материнским растением. Ранее считалось, что орхидею вообще невозможно вырастить из семян, но опытные цветоводы доказали, что это не совсем правда. Вырастить можно, но придется сильно постараться. Семечка орхидеи фактически невидима из-за своих крошечных размеров. У семян нет специального защитного слоя, соответственно они подвержены самым различным заболеваниям. Схема действий следующая: рассыпьте семена на поверхности влажного грунта и накройте их пленкой, создав небольшую теплицу. Почвой сверху присыпать не нужно. Не в коем случае не поливайте семена, достаточно будет редкого опрыскивания. Постоянно следите за вашей теплицей и подбирайте только лучший субстрат. Семена могут сгнить, покрыться плесенью или высохнуть.

Гораздо более эффективным считается размножение семян в пробирках или небольших герметичных банках. Перед началом следует тщательно продезинфицировать семена и емкости, а также подготовить субстрат. На 20 минут покройте семена однопроцентным раствором хлорной извести. При помощи шприца аккуратно введите раствор в питательную смесь (не более 45 мл в каждой емкости). Закройте емкости и перенесите их в теплицу. Семечки должны дать первые всходы уже через 6 месяцев. По прошествию необходимого времени, перелейте смесь в емкости с теплой водой и обработайте средством от грибков (напр. “Фундазол”). Перед высаживанием подготовьте субстрат. Он должен состоять из торфяного мха, активированного угля и древесной коры. Можно приобрести питательный субстрат для молодых орхидных в магазине. А уж через полгода разрешается пересаживать рассаду в обычную почву для орхидей. Чтобы вырастить орхидею таким способом, придется подождать несколько лет (в некоторых случаях до 7). Для приготовления питательной смеси залейте порошок агар-агара водой. Когда смесь загустеет, добавьте кипяченой воды, глюкозы, фруктозы и карбоната кальция. После этого тщательно перемешайте раствор.

Правила ухода за орхидеями

За орхидными необходимо внимательно присматривать в период роста, так как это довольно прихотливое растение. Полностью орхидея формируется на 3-4 год жизни. Флористы настоятельно рекомендуют высаживать культуру в прозрачные горшки. Во-первых, это даст возможность корням “дышать”, а во-вторых, позволит следить за состоянием корневой системы. После слишком обильного полива или из-за недостаточной влажности, корни орхидеи могут загнить. Справиться с этим очень тяжело, растение часто погибает вследствии плохого ухода. Тем не менее, если соблюдать все меры предосторожности, все будет хорошо.

Полив

Многие практикуют внекорневой полив, создавая вокруг цветка “туман из воды” путем опрыскивания растения. Для корневого полива днище емкости протыкают и опускают горшок в ванну или другую глубокую емкость. Растение само вберет столько влаги, сколько необходимо. Частота полива такая же, как и у взрослых представителей вида, но зависит от времени года и фазы активности. Корни настолько хрупкие, что могут самостоятельно “выбраться” на поверхность. В этом случае их можно прикрыть кусочками древесной стружки или мха, а затем опрыскивать вместе с листьями.

При появлении на листьях черных пятен стоит немедленно бить тревогу и начинать лечение. Это первый признак гниения. После появления на листьях черных клякс, плесени и ощутимого неприятного запаха, спасти растение уже вряд ли получится. В летнее время полив должен быть обильнее, чем в зимнее. Желательно, чтобы между поливами субстрат успел просохнуть. Если у вас дома орхидея сортов Дендробиум, Каттлея или Онцидиум, перед повторным поливом почва должна полностью высохнуть. Не заливайте растение и старайтесь, чтобы вода после распыления не застаивалась на листве. В противном случае на листьях будут появляются темные пятна. Растению нужны и систематические проветривания, но без сквозняка. Во время проветривания лучше ставить орхидею в дальний угол комнаты.

Грунт

Состав грунта имеет почти такую же важность, как и частота полива. Обычно субстрат готовится на основе опилок, древесного угля и мха. Если вы решили самостоятельно приготовить почву, обязательно продезинфицируйте ее фунгицидом или слабой настойкой марганцовки. Специалисты не рекомендуют изготавливать грунт для орхидей начинающим цветоводам. Лучше приобрести готовый в цветочном магазине. Горшок не должен стеснять рост орхидеи, но слишком просторная емкость также не подходит. Домашняя орхидея, как и комнатная лиана, нуждается в хорошей дренажной системе.

Сделайте в горшке множество отверстий и на ⅓ заполните его керамзитом или пенопластом. Помимо прочего, пенопласт обладает хорошими теплоизоляционными свойствами. Это будет особенно полезно в холодное время года, особенно если горшок с орхидеей стоит на холодном подоконнике или тумбе. Если решили сделать субстрат самостоятельно, то обратите внимание на его пористость. Для орхидеи очень важно, чтобы у корней был постоянный доступ к кислороду. Помимо этого, воздушный грунт не дает застаиваться вредителям и различным микроорганизмам, которые могут повредить нежные корни растения. Самый простой способ сделать домашний субстрат — это смешать мох, древесный уголь, кору деревьев (желательно сосновую) и немного кокосовых чипсов. Рецептов на самом деле множество, однако объединяет их всех стремление к наибольшей проводимости кислорода.

Подкормка

Подкармливают орхидеи обычно специальными комплексными удобрениями. Использовать их можно только в жидком виде. Однако, существуют и народные удобрения для орхидей, такие как: отвар на банановой кожуре, картофельный отвар или раствор из луковой шелухи. В препаратах часто содержатся хелаты и органические соли. А в подкормках зачастую низкая концентрация действующих веществ и малое количество азотных удобрений. Своевременное внесение подкормок гарантирует обильное цветение, красивую листву и бурный рост орхидеи.

Жарким летом и зимой подкармливают обычно не чаще 1 раза в месяц. Молодые растения нуждаются в подкормке 1 раз в неделю вместе с обильным опрыскиванием. Время внесения удобрений определяется непосредственно цветоводом. Перед новой подкормкой смойте остатки с прошлого раза теплой отстоянной водой. Если не перекармливать растение и соблюдать режим, можно продлить ему жизнь на несколько лет. Наибольшей популярностью пользуются все же неорганические удобрения “Агрикола”, “Фертик” и “Джой”. В отличие от многих других растений, если на орхидее новых почек не появляется, значит и подкармливать ее не нужно, и наоборот. Главное — соблюдать необходимую дозировку и учитывать индивидуальные особенности конкретно вашего сорта. В большинстве своем домашние орхидеи относятся к эпифитам, поэтому и подкормки нужно выбирать соответствующие.

Четыре способа размножения орхидей дома

11 февраля 2020

Орхидея — это один из прекраснейших цветков в мире и с этим мало кто не согласится. Она является тропическим растением и ее видов насчитывается огромное количество. Орхидея относится к очень нежным цветам, и разводить ее не так уж просто. Мы расскажем Вам все секреты размножения орхидей в домашних условиях.


Зачем размножать орхидеи

В основном размножением орхидей занимаются в промышленных масштабах. Она является очень популярным подарком для женщин на различные праздники и даже без повода. Цветками орхидей зачастую украшают свадебные букеты и прически невест, также используются в декорировании. Не отстают от промышленников и садоводы-любители, которых хотят иметь, как можно больше этих чудесных цветов.

Когда можно размножать орхидеи


К размножению, орхидеи готовы только будучи большими около 1.5 -3 года. Также возраст размножения орхидеи зависит от ее вида. К примеру, ждать размножения детками от орхидеи Фаленопсис после двух и даже трех лет не стоит, так как она предпочитает это делать перед самой смертью, поэтому следует использовать черенкование либо метод отводки. В основном, остальные виды орхидей готовы к размножению детками после полутора лет при должном уходе.

Хиты продаж в магазине

Основные способы размножения

Орхидеи дома можно размножать следующими способами:


Детками, а именно побегами, которые образуются сбоку у орхидеи. Иногда может появиться только одна детка – это зависит от возраста самой орхидеи. В таком случае орхидею нужно поливать чаще обычного и по мере роста побегов следует их отсадить, как самостоятельное растение. Процесс опускания корней детками занимает около трех месяцев. Во время срезания деток нужно быть предельно осторожными, чтобы не навредить орхидее. После следует присыпать место надреза древесным углем;


Отводками. Они могут образоваться в основном у симподиальных орхидей. В таком случае стебелек пригибается и сооружается небольшая тепличка, к примеру, из небольшой емкости. Предварительно в стебельке нужно сделать надрез, полить и ждать почек. В дальнейшем из почек появятся маленькие стебли с корнями. Когда они подрастут, их необходимо будет отделить от материнского стебля, но продолжать держать в теплице. В тепличке необходимо поддерживать тепло и влажность;

Вегетативным способом. При таком способе корень орхидеи разделяется и отсаживается по отдельности, но данный метод используют при условии, что орхидея большая. Место надреза следует присыпать древесным углем. При осуществлении деления орхидеи группы дендробиума необходимо, чтобы каждая отдельная часть имела свою почку. Орхидеи Фаленопсис не следует разводить данным методом;

Размножение цветоносом. Такой способ применяется к монопоидальным орхидеям. Основан он на размножении побегами, которые уже отцвели. Плюс данного способа в том, что растению не наносится никакого вреда. Необходимо, чтобы побег был зеленым и на черенке должно быть несколько спящих почек. После черенок помещают на сфагнум и ждут, создавая тепличные условия для роста нового растения. 

Несомненно, способ размножения необходимо подбирать к каждому виду орхидей индивидуально. Также следует помнить о правильном уходе до размножения и после, так как это очень важно для здорового развития растения.

Пользуются спросом после прочтения

Размножение орхидей — Орхидеи — праздник для глаз!

Орхидеи можно размножать двумя основными способами: бесполым — из частей материнского растения и половым — из семян. При бесполом размножении получают растения, генетически равные материнскому, а при половом способе размножения возникают экземпляры, не идентичные родительским растениям. Однако выращивать орхидеи половым способом значительно сложнее и длительное.

Деление
Наиболее просто размножать симподиально растущие орхидеи — нужно всего лишь разделить их корневище.
Часто эти растения разделяются самостоятельно. Важно, чтобы орхидея была достаточно большой. Каждая их отделенных частей должна иметь, по меньшей мере, 3 полностью развившихся ложных луковицы. Лучшее время для деления — начало весны. Это делается так:
• Выньте растение из горшка и отделите субстрат от корней.
• Острым ножом (продезинфицируйте его опаливанием) разрежьте корневище насквозь между ложными луковицами.
• Чтобы избежать заболеваний, посыпьте корневище порошком древесного угля.
• Теперь посадите в горшки, полученные описанным способом новые растения.

Размножение верхушечными черенками
Некоторые моноподиальные орхидеи с четкими расстояниями между узлами побегов (некоторые виды орхидей Ванда (Vanda)) также можно размножать верхушечными черенками. Для этого нужно отрезать побег на половинной высоте продезинфицированным ножом, а затем посадить черенок в горшок. Прежде чем сажать новое растение, следует продезинфицировать место разреза порошком древесного угля. Конечно, использовать этот метод стоит только для быстрорастущих видов. Всем другим потребуется несколько лет на то, чтобы черенок развился в растение, способное цвести.

Размножение «детками» («боковыми побегами»)
У некоторых видов орхидей родов Дендробиум (Dendrobium) и Фаленопсис (Phalaenopsis) образуются маленькие новые растеньица, так называемые «детки» или «боковые побеги». Если появился такой побег, Вам нужно часто его опрыскивать и ждать, пока он достаточно сильно подрастет и образует корни. Тогда Вы можете отделить новое растение и посадить его в отдельный, его собственный горшок. Перед пересаживанием нужно посыпать место разреза порошком древесного угля. Факторы, которые способствуют образованию «деток» у растений, — высокая температура в помещении, внесение удобрений с повышенным содержанием азота. Кроме того, в магазинах товаров для садоводства можно купить специальную меристема — образовательная ткань растений. Поскольку в последнее время при покупке орхидей все чаще встречается это название, мы кратко объясним этот метод. При тканевом (меристемном) размножении под микроскопом из точки роста материнского растения извлекают клетки, способные к делению (меристематические клетки). Эти клетки кладут в питательную среду, где они делятся. Получившиеся сгустки клеток разделяют и кладут в другую среду, в которой полностью образуются растения. Важно, чтобы этот процесс происходил в стерильных условиях. Таким способом за сравнительно короткое время можно получить тысячи генетически одинаковых орхидей

Семенное размножение
Размножать орхидеи половым способом достаточно сложно, потому что их очень маленькие семена не имеют питательной ткани. В природе семя орхидеи прорастает с помощью специального грибокорня микоризы или корневой губки, который снабжает его необходимыми питательными веществами. Садоводы-селекционеры для прорастания кладут семена в искусственную питательную среду. Но поскольку эта среда идеальна также и для развития плесневых грибков, этот процесс должен происходить в лаборатории в стерильных условиях. Здесь семя прорастает от 3 до 9 месяцев. Затем должно пройти еще 1,5-3 года, чтобы росток превратился в молодое растение, которое можно пересадить. Молодой орхидее потребуется еще от 2 до 4 лет, прежде чем она зацветет в первый раз. Орхидеи рода Венерин башмачок нередко впервые цветут только спустя 10 лет.

Краткая история гибридизации орхидей

Десятки тысяч видов орхидей были идентифицированы по всему миру, и время от времени обнаруживаются новые виды. Орхидеи — одно из самых плодовитых цветущих растений, и люди нашли способы сделать их еще более плодовитыми. Селекционеры орхидей создали более 100 000 гибридов орхидей за годы, и большой процент орхидей, которые продаются сегодня, являются искусственно созданными гибридами.

Это первый

Первая успешная попытка скрещивания орхидей была предпринята в 1850-х годах, когда Calanthe Dominyi начала производить цветы. Этот гибрид был создан Джоном Домини, главным производителем английской орхидейной фирмы Veitch & Sons. Вскоре за этим последовало расцветание более яркого гибрида, получившего название Cattleya Hybrida, и это ознаменовало начало новой эры гибридизации орхидей.

Меньшее количество гибридов орхидей было создано в конце 19 годов, потому что селекционеры все еще не могли определить, как микоризные грибы повлияют на прорастание семян орхидей. Примерно в начале 20–900–15– годов француз по имени Ноэль Бернар утверждал, что грибы необходимы для прорастания семян орхидей.Немец по имени Ханс Бургефф не согласился с ним, заявив, что прорастание семян можно добиться с помощью лабораторного агара и подходящего штамма грибов.

Открытие прорастания

В 1922 году была наконец открыта формула прорастания семян орхидей. Американский физиолог растений Льюис Кнудсон обнаружил, что семена можно проращивать на агаре и сахаре, производимом грибами, а не самими грибами, а также некоторыми минеральными питательными веществами. Это привело к массовому производству гибридов орхидей в лаборатории и созданию множества новых гибридов, которое продолжается и по сей день.

Хотите узнать больше о гибридах орхидей?



Олимпийские игры Орхидеи |
Наука | Смитсоновский журнал

Орхидеи — соблазнители. Они обманом заставляют животных опылять их и обычно ничего не дают взамен. Некоторые виды орхидей имитируют цветы, производящие нектар, чтобы заманить пчел; другие источают зловонный запах гниющего мяса, чтобы привлечь падальщиков. В Китае орхидеи Dendrobium sinense выделяют химическое вещество, которое обычно распространяется пчелами, терпящими бедствие; Аромат привлекает пчелоядных шершней, ожидающих легкой еды.Запах Cymbidium serratum соблазняет дикую горную мышь, которая своей мордой разносит пыльцу от цветка к цветку. Во всем мире виды орхидей эволюционировали, чтобы выглядеть или пахнуть как женские насекомые; самцы пытаются спариваться с цветками, но собирают и откладывают пыльцу, которую продолжают бегать от обмана к обману.

Но, пожалуй, наиболее яркое свидетельство притягательной силы растения можно было увидеть несколько недель назад в Сингапуре на 20-й Всемирной конференции по орхидеям, проводимой раз в три года мероприятии, которое привлекло около 1000 участников из 55 стран и более 300 000 зрителей.Это был один из крупнейших конкурсов орхидей в истории, красочное мероприятие с сильным запахом, которое продемонстрировало растущую популярность и передовые научные достижения в селекции орхидей.

«Орхидеи — такие манипуляторы. После птиц и пчел они соблазнили нас, людей, совершить за них грязное дело », — пошутил Киат Тан, председатель оргкомитета конференции.

За день до конференции выставочный зал площадью четыре акра в конференц-центре Сингапура был завален полуоткрытыми ящиками: «Хрупкий! Обращаться осторожно.Хранить при 8 градусах Цельсия ». Сотни выдержавших смену часовых поясов экспонентов аккуратно извлекли из упаковки срезанные цветы и орхидеи. Некоторые возили свои орхидеи вручную на рейсах и через таможню с необходимыми сертификатами, подтверждающими, что растения не заражены болезнями и разрешены к перевозке в соответствии с Конвенцией о международной торговле видами, находящимися под угрозой исчезновения.

Цветы «страдают, если слишком холодно или потеют, если в ящиках слишком тепло», — сказал Крис Пурвер, заводчик орхидей и куратор Фонда Эрика Янга орхидей на острове Джерси, зависимом от британской короны.«У нас было несколько бессонных ночей, чтобы доставить их сюда».

Члены южноафриканского общества орхидей, разочарованные тем, что правила международной торговли запрещают им ввозить настоящие части животных или живых птиц, с раздражением построили в джунглях выставку с поддельными леопардами, рогами носорогов и слоновьими бивнями.

Джастин Ткаченко из Общества орхидей Папуа-Новой Гвинеи завершал работу над экспозицией, включающей гигантские резные маски и птицу из орхидей.«Мы стремимся быть лучшими в мире. Это будет самая фотографируемая выставка на всей выставке », — сказал он.

Орхидеи могут быть самым разнообразным цветочным семейством в мире, насчитывающим более 25 000 видов. (Их единственная конкуренция исходит от маргариток.) ​​Семейство орхидей поддерживает такое разнообразие в дикой природе отчасти потому, что отдельные виды орхидей вызывают только определенных опылителей; таким образом цветы избегают смешивания своих генов с генами других близлежащих орхидей, которые посещают их собственные опылители.Но большинство из 50 000 орхидей из 5 000 разновидностей, представленных на конференции, не произрастают в дикой природе; это гибриды, созданные людьми, у которых есть перекрестно-оплодотворенные виды орхидей, часто из далеких стран.

«Удовольствие от разведения орхидей — это увидеть, сможете ли вы объединить два вида, чтобы создать что-то еще более красивое, чем любой из родителей», — сказал Мартин Мотс, коммерческий производитель из Флориды и судья конференции, когда посетители хлынули в зал. и толпились вокруг дисплеев.Он занимается разведением орхидей в течение 40 лет, и многие разновидности его 500 гибридов названы в честь его жены Мэри. «Моя жена думает, что я играю Бога! Что ж, я полагаю, человеку дана власть над животными полей и орхидеями в оранжерее », — сказал он.

Заводчик орхидей начинает с видения — цвета, формы, размера, аромата и долговечности желаемого цветка — а затем ищет идеальных родителей. «Когда мы создаем орхидеи для знаменитостей и делегатов, мы также учитываем их вкусы, характеры и род занятий, — сказал Тим Ям, старший научный сотрудник и селекционер орхидей Сингапурского ботанического сада.«Например, орхидея, названная в честь принцессы Дианы, была белой — цвета королевской семьи — и очень ароматной. Но если это для премьер-министра или президента, мы могли бы выбрать более глубокий цвет и величественный спрей ».

В Лаборатории разведения и микроразмножения орхидей Ботанического сада Сингапура Ям показал мне, как выращивают орхидеи в лаборатории. Крошечные семена насыпают питательными веществами в стерильную стеклянную колбу; через несколько месяцев рассаду переносят в новые колбы. Как правило, первый год они проводят под стеклом, второй год — в общественных горшках, третий — в индивидуальных горшках для большого пальца.Только через четыре года они начинают цвести. Затем клонируют растения с наиболее благоприятными характеристиками, такими как сила роста, длина распыления, а также размер, форма и цвет цветов. Меристему, или верхушку роста, отрезают от орхидеи и встряхивают в колбе. Обычно меристема дает один побег, но «встряхивание растительной ткани сбивает ее с толку, и она начинает давать много побегов», — сказал Ям. Производители разделяют побеги, чтобы получить клоны одного и того же гибрида.

Прошли те времена, когда владение орхидеей было роскошью.Благодаря клонированию орхидеи можно выращивать массово, а стебель можно купить в продуктовом магазине за 20 долларов. Орхидеи являются наиболее продаваемым видом горшечных цветочных растений в Соединенных Штатах, где объем оптовых продаж в 2010 году достиг 171 миллиона долларов, что на 6 процентов больше, чем годом ранее.

На конференции английский профессор на пенсии, животновод из Южной Африки, патентный поверенный из Сингапура и итальянский модельер, живущий на Бали, смешались в толпе. Люди обсуждали пышные тела с гладкими формами, безупречной кожей, яркой осанкой и идеально изогнутыми сочными губами.

«Орхидеи очаровательны, потому что имеют такую ​​же форму, как и мы — два чашелистика и два лепестка с каждой стороны», — сказал Моутес, жестикулируя ногами, похожими на чашелистики, и руками, похожими на лепестки. «Есть спинной чашелистик вверху, центральная колонна и губа внизу, которые на самом деле являются посадочной площадкой для потенциальных опылителей», — продолжил он. «Эта сложная структура орхидей имеет тенденцию быть чувственной и затрагивает что-то первобытное в нас на подсознательном уровне».

Другой участник выставки, Харухико «Гарри» Нагата, и его семья перевезли из Японии в Сингапур 275 орхидей и 26 срезанных цветов.«Я выращиваю орхидеи 35 лет, и для меня разведение орхидей — это развлечение и ожидание — опыление двух растений с разными характеристиками и получение первого цветения через несколько лет!» он сказал. Претендентом Нагаты на главный приз шоу была яркая белая орхидея с экзотической пурпурной губой, которую назвали Микки Нагата в честь его жены. Указывая на розовый цветок, он сказал: «Это каттлея Джимми Нагата, названная в честь моего сына. Очень, очень паршиво, — пошутил он, указывая на своего сына вдалеке.«Но с цветком все в порядке!»

Когда началось судейство, более 200 знатоков, большинство из которых были с волосами цвета соли и перца, были одеты в свободную одежду и удобные кроссовки, перебегали от одного экспоната к другому, вооружившись оценочными листами, измерительными лентами и лазерными указками. Одни осматривали их издалека, другие сидели на корточках и аккуратно поднимали листья ручкой.

«Мои цветы действительно преуспели, много медалей и лент», — сказал Пурвер, производитель с острова Джерси.«Я буду разочарован, если не выиграю большой приз».

Но его работа заняла второе место в категории лучших растений, уступив тайваньскому конкуренту, чья победившая орхидея Cycnodes Taiwan Gold имела насыщенный желтый цветок, напоминающий форму лебедя. Общество орхидей Папуа-Новой Гвинеи также выиграло приз, занявший второе место в общем показе. Вытирая слезы радости, Ткаченко сказал: «Это просто сенсация. Кто знал, где находится Папуа-Новая Гвинея, а теперь мы сражаемся с лучшими в мире! »

Сомали Рой — писатель из Сингапура. JG Bryce , базирующаяся в Тайбэе, Тайвань, работает над арт-проектом о восприятии и обмане.

разведение орхидей — My Chicago Botanic Garden

С нашей выставкой орхидей, которая откроется в середине февраля, и первой партией цветов, которая должна прибыть в любой день, у всех нас в Ботаническом саду Чикаго присутствует легкая лихорадка орхидей.

Естественно, мы задавались вопросом, у кого из нас может быть наихудший случай (или лучший, в зависимости от того, как на это смотреть).Поэтому мы разослали простой вопрос: выращиваете ли вы орхидеи дома? Здесь следует лучший ответ Джима Олта, доктора философии. (Он наш директор по исследованиям декоративных растений и менеджер программы внедрения растений Chicagoland Grows.)

Вид из окна кухни в доме Олт.

Да, я действительно выращиваю орхидеи дома. Я их в последнее время не считал, но допускаю, что более 50 растений.

Я просто нахожу орхидеи завораживающими из-за их, казалось бы, бесконечных вариаций размеров, форм, цветов, ароматов (очень важно для меня!), Разнообразных экологических приспособлений (эпифиты, наземные растения, литофиты) и возникающей в результате загадки того, как лучше всего культивировать их.Впервые я заинтересовался орхидеями в 1970-х годах, когда увидел некоторые из них в оранжереях Мичиганского университета, а также после того, как навестил бабушку в Майами. Она была очень активна в обществе папоротников Флориды того времени, и у нее был задний двор папоротников, которые она вырастила из спор, с небольшой коллекцией орхидей. Она присылала меня домой с растениями при каждом посещении, все из которых я в конечном итоге терял, так как понятия не имел, как их выращивать! Но теперь я думаю, что с уверенностью могу сказать, что меня зацепило на всю жизнь.

Rhynchostylis gigantea

Как аспирант в 1980-х годах у меня была довольно обширная коллекция орхидей, и я фактически селекционировал их и проращивал их семена в культуре тканей; мои первые селекционные проекты. Это хобби фактически привело меня к моей карьере селекционера (многолетних растений) сегодня. Я был членом Общества орхидей Батон-Руж в течение пяти или шести лет, посетил немало выставок и встреч орхидей, читал лекции по орхидеям и имел возможность посетить некоторые из уважаемых предприятий орхидей, такие как Stewart Orchids в Калифорнии, Fennell’s Orchid Джангл, Джонс и Скалли во Флориде, возможно, на пике своего расцвета.Но от моей коллекции орхидей пришлось отказаться в конце 80-х, когда я переехал в Пенсильванию. Большинство из них было продано питомнику в Северной Каролине, а некоторые были переданы в дар Longwood Gardens, где я работал с 1988 по 1995 год.

Мое увлечение орхидеями приходило и уходило несколько раз за прошедшие годы (десятилетия), в основном из-за нехватки подходящего места для их выращивания, времени и т. Д. Но примерно три года назад я снова начал серьезно накапливать растения. Пришлось немного научиться, так как многие из известных мне гибридов больше не были доступны; произошел взрывной рост новых гибридов орхидей, многие из которых были мне неизвестны; а также названия орхидей быстро меняются из-за использования современной ДНК-технологии для пересмотра их номенклатуры.Просто выяснить, где купить растения, было приключением, поскольку большинство известных мне питомников орхидей давно исчезли.

Slc. Little Toshie ‘Gold Country’ (верхний) и Sc. Seagull’s Beaulu Queen (нижний)

В настоящее время я выращиваю в основном каттлей альянсовых видов и гибридов, с акцентом на «мини-кошек» или миниатюрные каттлеи , а также небольшое количество более крупных каттлей . Среди моих фаворитов в этой группе — Cattleya walkeriana с их пьянящим сочетанием аромата корицы и цитрусовых (до моего носа) и их гибриды, такие как Cattleya Mini Purple; различные виды, ранее входившие в род Laelia , такие как Laelia pumila , (= Cattleya pumila ), Laelia dayana (= Cattleya bicalhoi ), Laelia sincorana (= Cattleya sincorana ), и другие близкие драгоценности мира орхидей.

Я очень рад, что прямо сейчас цветет крошечный Sophronitis coccinea (= Cattleya coccinea ) с огромными оранжево-красными цветками шириной 2 дюйма на растении не более 3 дюймов высотой. S. coccinea сложно вырастить вообще, не говоря уже о том, чтобы хорошо расти, но его гибриды намного легче выращивать, и они выделяются яркими цветами темно-красного, оранжевого, пурпурного и фиолетового цветов, часто получаемых двумя и даже три раза в год.

Я также выращиваю небольшое количество других видов и их гибридов, в основном Neofinetia falcata , Rhynchostylis gigantea и родственные гибриды.

Laelia pumila ‘Hawaii’

Я выращиваю большинство своих орхидей в смеси коры, некоторые в новозеландском сфагнуме. Я использую как пластиковые, так и глиняные горшки, а также пластиковые или деревянные корзины. Я предпочитаю последнее, так как растения лучше всего реагируют на отличную аэрацию вокруг своих корней, которую обеспечивают открытые деревянные корзины. К сожалению, это также представляет собой проблему, поскольку нужно выяснить, как подвесить корзины достаточно близко к окнам, чтобы обеспечить необходимое яркое освещение, а также обеспечить достаточную влажность в сухие зимние месяцы.

Мои растения проводят лето на свежем воздухе на детской скамейке под куском теневой ткани и зимуют в помещении при свете в подвале и почти во всех окнах дома, выходящих на юг! Моя семья заслуживает похвалы за их страдания — и терпение — после того, как они обнаружили раковины и ванны, заполненные свежей водой, или загороженные виды из окон, заполненных растениями. Такова жизнь орхидейного наркомана.

Шоу орхидей открывается в середине февраля — прекрасный способ отпраздновать День святого Валентина.Закажите билеты прямо сейчас!


© 2015 Чикагский ботанический сад и my.chicagobotanic.org

Сбор и торговля дикорастущими орхидеями в Непале | Journal of Ethnobiology and Ethnomedicine

Лекарственные орхидеи Непала

Сообщается, что 60 видов орхидей использовались для лечения 38 различных заболеваний (Таблица 1), что составляет 15% от общего числа орхидей, описанных в Непале. В недавнем обзоре литературы, проведенном Ачарьей и Рокайя [9], было обнаружено 82 вида лекарственных орхидей, зарегистрированных в Непале, 47 из них также были обнаружены в этом исследовании, сосредоточенном на ограниченной территории.Hossain [5] в обзоре мировой литературы по лекарственным орхидеям показывает, что всего 129 видов используются для различных терапевтических целей. Восемьдесят две орхидеи, используемые в Непале в медицинских целях, означают, что разнообразие традиционных видов орхидей в стране исключительно велико. Такое большое количество можно объяснить тем, что наше исследование — первое этноботаническое исследование, посвященное исключительно орхидеям. Кроме того, использование штрих-кодирования ДНК позволило более точно идентифицировать виды стерильного материала, чем это может быть достигнуто при морфологических исследованиях (таблица 2).

Таблица 2
Штрих-код ДНК стерильных лекарственных орхидей

Ачарья и Рокайя [9] зарегистрировали 82 вида лекарственных орхидей для Непала, 34 из которых не были зарегистрированы в этом исследовании, тогда как в этом исследовании было зарегистрировано еще 12 видов. В совокупности оба исследования составили 94 вида орхидей, используемых в медицине. Большинство из них — эпифиты, четверть — наземные и лишь немногие — литофиты. Coelogyne , Dendrobium , Cymbidium , Bulbophyllum , Habenaria , Malaxis и Pholidota — это роды, большинство видов которых используются в качестве традиционных лекарств.Другие зарегистрированные виды использования этих лекарственных орхидей — это корм (25), овощи (6), а также ритуальное и церемониальное использование (6) [10].

Наиболее распространенные названия орхидей — Sungava и Sunakhari . Кроме того, было зарегистрировано 23 местных названия орхидей, которые использовались местными сообществами в различных частях Непала (Таблица 1). Среди них наиболее распространены: Thuur или Thurjo (мохоподобные растения, растущие на стволах деревьев), Parajivi (паразитическое растение), Bankera (псевдолуковицы в форме дикого банана), Banaduwa ( имбирь), Chandigava (цветы серебристого цвета), Shaktigumba (псевдобульбы, дающие энергию) и Chadephul (цветы, вызывающие рвоту).Названия на местном языке отражают обширные знания местных сообществ в отношении привычек выращивания орхидей, их среды обитания и их потенциального использования.

Основные зарегистрированные местные применения включают афродизиаки, антидепрессанты и лечение ожогов кожи, переломов или вывихов костей, головных болей, лихорадки и ран. Другие применения включают репелленты от насекомых, очиститель крови, кожные грибки, противоядие от укусов змей и скорпионов, побуждение к абортам и восстановление после родов. Орхидеи в основном используются в виде пасты, порошка или сока, отдельно или в смеси с молоком, медом или пшеничной мукой.Экстракты орхидей употребляют перорально или применяют наружно. Широко распространенное местное использование Coelogyne заключается в употреблении в пищу свежесрезанных ломтиков псевдобульбы в качестве утоления жажды.

Дикие виды орхидей в торговле

Из общего количества 60 видов диких орхидей, зарегистрированных как продаваемые с исследуемых участков, 28 видов были экспортированы как в медицинских, так и в садоводческих целях, а 32 вида — только в лечебных целях. Множественная потребительная стоимость усугубляет угрозу чрезмерной эксплуатации этих видов.В лечебных целях виды, относящиеся к родам Acampe , Aerides , Coelogyne , Crepidium , Dactylorhiza , Dendrobium , Gastrodiainger , 171 Gastrodiainger , 171 Наиболее интенсивно эксплуатируются Pholidota , Satyrium и Vanda , судя по тому, сколько раз они цитировались респондентами. Acampe praemorsa , Aerides multiflora , Bulbophyllum careyanum , Coelogyne cristata , Co . nitida , Crepidium acuminatum , Dactylorhiza hatagirea , Dendrobium aphyllum , De . crepidatum , De . eriiflorum , De . moschatum , Eulophia Spectabilis , Flickingeria fugax , Gastrodia elata , Otochilus albus , Pholidota pallida , Ph . imbricata и Vanda cristata — самые разыскиваемые виды для ритуалов. Coelogyne cristata , Co . flaccida , Со . nitida , Cymbidium iridioides , Dendrobium densiflorum и Vanda cristata наиболее широко используются в качестве срезанных цветов.

Коллекционеры орхидей и методы сбора

Собиранием диких орхидей занимались преимущественно местные молодые люди, женщины и дети, и всего на участках исследования было зарегистрировано 42 сборщика. В Дакшинкали, по крайней мере, 18 местных коллекционеров участвовали в сборе орхидей, поставляя орхидеи 10 местным продавцам.Сами продавцы иногда также занимались сбором диких орхидей. Некоторые местные коллекционеры сообщили, что занимались сбором и продажей орхидей более 25 лет.

Лекарственные орхидеи обычно собирали с декабря по апрель, а пиковый период — с января по март. Для цветоводства период сбора был круглый год в зависимости от наличия цветущих особей. Коллекционеры сообщают, что ищут орхидеи повсюду, часто преодолевая более 10 км пешком через лес.Эпифитные орхидеи, растущие высоко в кронах деревьев, собирали путем вырубки деревьев, если это было возможно, и предпочтительно собирали группами. Наземные орхидеи собирали путем выкопки клубней, чтобы собрать все растение.

Сбор диких орхидей обычно начинается после получения заказа от посредников. Эти люди обычно оставались поблизости от мест сбора орхидей на протяжении всего периода сбора. Иногда сборщики получали авансовые платежи. Посредники обычно приезжали из отдаленных районов или даже из-за границы и предоставляли печатные фотографии желаемых видов или небольшие образцы живых орхидей и просили коллекционеров собрать похожие на вид растения.Пример такой фотографии был получен от посредника, который получил ее от международных торговцев из Гонконга (рис. 2E). Местные жители собирали все найденные орхидеи, даже если они не походили на виды на фотографиях, предоставленных посредниками. Ни одна из собранных орхидей не была выброшена в торговых точках. Большинство сборщиков проводят в лесу в среднем 5-6 часов в день. Орхидеи несли в бамбуковых корзинах (Figrue 2A-D) или в джутовых мешках до ближайших торговых точек.За последние 15 лет крупномасштабная коллекция орхидей в Непале увеличивалась из года в год, судя по объемам торгов, указанным респондентами.

Рисунок 2

Торговля незаконно собранными лекарственными орхидеями в Непале. 2 А . Dendrobium eriiflorum (фото: Б. Кунвар). 2 В . Coelogyne вида в торговых точках (фотография А. Субеди). 2 С . Flickingeria fugax (фото А. Субеди). 2 Д . Aerides и Dendrobium в традиционных бамбуковых корзинах (фотография: B.B. Raskoti). 2 E . Dendrobium eriiflorum из Непала в супермаркетах Гонконга (фотография: Аноним).

Торговые точки на рынке диких орхидей

Дакшинкали, в 22 км от Катманду, является центром торговли дикими орхидеями в Непале. Орхидеи продаются уже более 25 лет. В Дакшинкали есть как минимум 10 продавцов, специализирующихся на торговле дикими орхидеями.Еще одним важным торговым центром является Годавари, недалеко от Катманду, но торговля орхидеями здесь постепенно сокращается за последние пять лет. Дакшинкали славится своим историческим храмом индуистской Кали, и каждый год до 400 000 паломников посещают этот храм и покупают дикие орхидеи, которые играют важную роль в церемониальных ритуалах. Многие владельцы отелей в Катманду покупают дикие орхидеи в Дакшинкали. Эти орхидеи легко узнать по их традиционным плетеным корзинам из бамбука, которые созданы специально для продажи диких орхидей и не встречаются больше нигде в Непале.

Шоссе восток-запад в тропической части центрального Непала — еще одно очень активное место для торговли орхидеями. Здесь нет фиксированных мест продажи орхидей, но каждый год посредники и / или местные торговцы сообщают коллекционерам, куда следует привезти орхидеи. В этих временных торговых точках орхидеи взвешиваются и продаются, большие объемы загружаются на грузовики или тракторы и нелегально перевозятся в Индию или Китай.

Объем торговли дикими орхидеями и местный доход

Пик сезона торговли орхидеями в Дакшинкали приходится с июля по октябрь.В этот период 2008-2009 годов каждый продавец живых орхидей продавал в среднем 15-20 горшков в день, что в среднем составляет 2-2,5 кг орхидей. Если экстраполировать на годовой объем продаж на одного поставщика, это в среднем составляет 4,4 тонны орхидей в год (2,25 кг × 17,5 горшков × 7 дней × 16 недель). Продавцы продавали как вегетативные, так и цветущие орхидеи, но цены на последние были самыми высокими. Популярные виды, такие как Dendrobium densiflorum , Coelogyne cristata , Cymbidium iridoides и Cymbidium erythraeum , торгуются по самым высоким ценам.Цена на орхидеи для целей садоводства сильно колебалась и колебалась, но в среднем составляла 1,0–1,5 доллара за горшок. Эта средняя цена позволяет нам приблизительно оценить годовой доход продавца от торговли орхидеями: 17,5 горшков x 1,25 доллара США x 7 дней x 16 недель = 2450 долларов США.

Местные торговцы лекарственными орхидеями и посредники сообщили, что торговля орхидеями в последнее время снизилась из-за ареста ряда нелегальных торговцев. Сообщается, что коллекционеры зарабатывают в среднем 2 доллара США за килограмм лекарственных орхидей по цене от 1 доллара США.5-2,5 в зависимости от вида и качества орхидей. Основываясь на интервью, мы оцениваем годовой объем торговли в 5 тонн в 2008-2009 гг., Что дает совокупный годовой объем для Дакшинкали 9,4 тонны диких орхидей за этот год.

Подробные экспортные цены на дикие орхидеи, собранные на участках исследования, не могли быть оценены, поскольку торговцы отказались предоставить эти данные. Один трейдер сообщил нам, что переработанный Dendrobium eriiflorum был продан по цене 10 000 гонконгских долларов (~ 1300 долларов США) за кг.Это соответствует общему мнению о том, что дикие орхидеи из Непала на международном рынке продаются по более высоким ценам, чем на внутреннем рынке.

Легальные и нелегальные направления торговли непальскими орхидеями

Интервью с коллекционерами, посредниками и местными торговцами показали, что большая часть диких орхидей, собранных в Непале, экспортируется в Индию и Китай, а иногда и в Гонконг. Ни один из участников не получил разрешения от местных властей. Местные торговцы в основном экспортировали сырые или иногда полуфабрикаты, сушеные и очищенные продукты.Наши результаты подтверждают предыдущие сообщения о незаконной торговле непальскими орхидеями [13, 15]. Shakya et al. [14] сообщили, что дикие орхидеи из Непала экспортировались в европейские страны для целей цветоводства, при этом ни один из экспортируемых видов не выращивался в питомниках. Непальские газеты часто сообщают о случаях задержания контрабандистов орхидей с огромным количеством диких орхидей для экспорта в Китай.

Орхидеи: выращивание и разведение | Цветок

Прочитав эту статью, вы узнаете о: — 1 . Цветок орхидеи 2. Прорастание семян орхидеи 3. Выращивание 4. Горшки / контейнеры 5. Разведение 6. Вредители и болезни.

Относится к важным однодольным растениям серии микроспермей, отряду орхидных и семейству орхидных. Это семейство включает около 800 родов и 35 000 видов и является самым большим семейством среди цветковых растений. Орхидеи имеют широкое происхождение и в изобилии доступны в тропиках и регионах с умеренным климатом, однако основными центрами являются: Индо-малайские и тропические регионы Америки, такие как Бразилия, Мексика и другие регионы, Новая Гвинея и Австралия.

Основными регионами Индии являются Гималаи — Сикким, Мегхалая, Трипура, Ассам, Бенгалия, Западные Гаты Северной Канары, Малабар и Траванкор. Обнаружены важные роды: Eria, Dendrobium, Cymbidium, Vanda, Perisylus, Calanthe, Orchis, Bulbophyllium, Liparis, Coelogyne, Paphiopedila, Vanilla, Rynchostyllus, Aerides, Microstylis, Spiranthes, Epipactisye, Hemepelia, Brazilian catteraasley, Brazilian catteraasley и др. . Мексиканская лелия и индийский дендробиум, цимбидиум Ванда сыграли важную роль в развитии индустрии орхидей.

Орхидеи — это многолетние, наземные, эпифитные, сапрофитные и промежуточные травы с корневищами или псевдолуковицами, клубневидными корнями или ассимилирующими корнями или воздушные эпифитные. Привычка к росту может быть моноподиумной или симподиумной.

У моноподий главная ось продолжает расти год за годом и несет цветы на боковых ветвях, например. Vanda, Angaecum, Polyrhiza, тогда как у симподиума, когда главная ось состоит из годовых частей последовательной оси, каждая из которых несет чешуйчатые листья и верхние цветки, называется Acranthos sympodium e.грамм. Эульфия, Дендробиум и Липарис.

Другая привычка, при которой соцветие является боковым, а главная ось продолжает расти в текущем году и перестает расти в конце сезона, называется Pleuranthos sympodium, например Цимбидиум, Phaius, Calanthe, Bulbophyllum и др.

В зависимости от среды обитания орхидеи делятся на четыре основные группы:

(i) Эпифиты:

Эти орхидеи растут на деревьях и укрепляют свою опору с помощью цепляющихся корней, которые возникают из корневищ и образуют сеть между орхидеей и опорой и образуют резервуар для перегноя.У этих орхидей есть поглощающие корни, которые являются придаточными и выступают в резервуар, содержащий гумус.

Воздушные корни свисают, зеленые внутри и способны накапливать воду и фотосинтезировать пищу. В засушливый период они сбрасывают листья, но несут цветы и многолетние с помощью псевдолуковиц, например. Дендробиум, Ванда, Бульбофиллум, Оберния и др.

(ii) Наземные орхидеи:

Это симподиум, обычно имеющий корневище, клубневидные корни или псевдолуковицы.Они являются ксерофитными или мезофитными и являются многолетними по своей природе, они хранят пищу и воду в измененных частях растений, что позволяет им преодолевать засушливый период. Каждый однолетний побег перерастает в листовой побег и соцветие.

(iii) Литофиты:

Эти орхидеи растут на влажных и затемненных скалах и уступах каменных стен, например. Cymbidium munroniamum, Diplomeris hirsuta, Geodoram durpureanum и Hernanium josephii.

(iv) Сапрофиты:

У этих орхидей отсутствуют зеленые листья и имеется мясистое подземное корневище с (Neotha) или без корней (Epipogium).Корневище обычно разветвленное и впитывает влагу из перегноя почвы. Эндотрофная микориза встречается почти у всех сапрофных орхидей.

Цветок орхидеи :

Самая эффектная часть орхидеи — это ее цветок, который может образовывать одиночную верхушку (Cyperipedium, Pogonia) или обычно колос, иногда в кисть. Цветки обычно трехкомпонентные, различаются по форме и размеру. У Angraecum sesquipedale с Мадагаскара белые цветки имеют диаметр 25 см и длину шпорца 45 см.

Околоцветника обычно шесть в двух оборотах, по три в каждом, и оба оборота могут быть одинаковыми, или внешний оборот может быть похож на чашечку, а внутренний — на венчик. Есть много модификаций. Задний лист околоцветника, или внутренний оборот, любопытно видоизменен и может быть шпорцевым, шпорцевым, бабочкообразным, трубчатым, широким, ремешком, башмаком, лопастным или рваным, мешочковидным, паучьим и т. Д.

Этот модифицированный тейпель, называемый губой или губой, служит местом посадки насекомых. Боковые листочки околоцветника внутреннего ряда могут оставаться отдельными и образовывать структуру, подобную крылу, или могут сливаться, как структура капюшона или пакетика, и обычно аналогичны.Доли околоцветника причудливо окрашены и имеют разнообразный и пестрый рисунок.

Андроций состоит из одной, двух или трех фертильных структур и переменного количества стаминоидов, расположенных в двух оборотах. Тычинки и столбик срастаются, образуя столбик, гинодрий или гиностемию. Столбец находится напротив лабеллума. Пыльники бычковатые, расщепленные, продольные, пыльца многочисленная, зернистая, обычно агглютинированная в мучнистые, восковидные или костные массы, называемые пыльцами, количество которых варьируется от 1 до 4 в каждом пыльнике.

Gynaecium состоит из трех лопастей рыльца, две из которых плодовитые, а одна — плодородная, которая представляет собой оплетенный rostellum. Яичник трехкарпеллярный, одноглазный, с краевыми расширениями, семяпочки мелкие. Опыление осуществляется насекомыми, и существует большое разнообразие цветков орхидей для опыления разными видами насекомых.

Цветки с нектарником в отростке губной губы или в основании столбика. Насекомое приземляется на губу и пытается добраться до нектарника. Липкая масса пыльцы приклеилась к его телу, пока он сверлял в поисках меда.Некоторые виды орхидей привлекают самцов многих гимоноядных насекомых, выделяя феромоны и их самый необычный метод выделения их поллиний.

Плод представляет собой коробочку, которая раскрывается с помощью трех-шести продольных боковых прорезей. Семена не являются эндоспермическими, эндоспермическими или эндоспермическими ядрами и производятся в большом количестве, чрезвычайно легкие и с недифференцированным зародышем. Производится до 40 000 000 семян на капсулу. Семена разносятся ветром.

Прорастание семян орхидеи :

Семена орхидей, не являясь эндоспермическими по своей природе, не могут использовать свои собственные запасы и гидролизовать более крупные молекулы крахмала или целлюлозы.Следовательно, в естественных условиях семена прорастают после поражения грибком — микоризией орхидеи, которая снабжает сахаром прорастающие семена орхидей.

В результате асимбиотическое прорастание в отсутствие сахара предшествует только стадии раннего протокорма. После анализа салепа орхидеи, содержащего крахмал, белки, сахара, минералы, и проросшие семена Cattelya, Laelia, Epidendrum или искусственные среды.

Льюис Кнудсон (1966) утверждал, что грибок не нужен для прорастания семян.Позже многие рабочие использовали различные среды для выращивания семян орхидей; однако обычно используются среды Кундсона и Вацина и Вента, которые доступны на рынке в готовой форме.

Состав важных сред приводится ниже:

Семена зеленых стручков высевают на автоклавированные среды в асептических условиях. Через 15-20 дней зародыш начинает набухать, а через 30-35 дней достигается 2 стадии листьев.На стадии 4 листьев сеянцы вынимают из колб и после тщательной промывки высаживают в общественные горшки в смеси измельченных волокон древесного папоротника и древесного угля в соотношении 1: 1.

Орхидеи размножают методом тканевых культур для получения безвирусных саженцев редких растений или гибридов, которые иначе нельзя было бы размножить. Были использованы коммерчески узловые срезы и в некоторых случаях боковая меристема почек или эксплантаты из побегов, растущих на псевдолуковицах, или черенков цветочных стеблей, или кончиков листьев.Сначала выращивают мериклоны, а при их пересадке получают растения орхидей. Существуют коммерческие лаборатории, которые занимаются коммерческим размножением орхидей и получают хорошую прибыль. Для культивирования тканей используются твердые или жидкие среды.

Выращивание орхидей :

Домики для орхидей созданы для выращивания орхидей. В зависимости от типа орхидеи обеспечиваются подходящие условия и среда для укоренения. Таким образом, домики для орхидей созданы для тропических орхидей или орхидей умеренного климата.Первые выращивают в тени или при непрямом освещении, при высокой влажности и не любят резких перепадов температуры, тогда как последние выращивают в прохладных помещениях для орхидей. Эти дома построены с севера на юг из колотого бамбука, стекла, стекловолокна и т. Д.

Оптимальная потребность в освещении зависит от выращиваемого вида. Cyperipedium и Phalaenopsis требовали всего 2200-3200 люкс, тогда как родам, таким как Vanda и Aranda, требовалось около 8500 люкс. Было замечено, что фильтрованный солнечный свет стимулирует образование мужских цветков, а прямой солнечный свет благоприятствует женским цветкам.Большинство орхидей нейтральны к дневному свету и не зависят от продолжительности светового дня. Но в Каттелее встречаются растения как короткого, так и длинного дня.

Есть также орхидеи, которые выращивают на открытом солнце в траншеях, заполненных куском кирпича, древесным углем. Таким способом орхидеи выращивают в коммерческих целях в Тривандруме, Цейлоне, Таиланде и Сингапуре. Выращиваются виды Ванда, Арханис, Аранда, Рананта и др.

Влажная и теплая атмосфера идеально подходит для роста большинства тропических орхидей, не имеющих хорошо развитой корневой системы.Следует поддерживать влажность в пределах 30-80% в ночное и дневное время соответственно. Для этого в домике для орхидей очень помогает центральный резервуар с водой. Растения в горшках, корзинах и подвесных горшках необходимо поливать два-три раза в день мелким распылителем, чтобы растения не пострадали напрямую.

Горшки / контейнеры для орхидей :

Наземные орхидеи выращивают в горшках, и их размер должен соответствовать размеру растения. Обычно используется горшок 25 см.Орхидеи не тревожат до тех пор, пока не возникнет необходимость, поэтому пересадку проводят через 2-3 года. Орхидеи лучше цветут в горшках. Горшки наполнены смесью листовой плесени. F.Y.M. и песок в соотношении 1: 1: 1. Добавление древесного угля или волокон папоротника, кокосовой шелухи или обожженного кирпича улучшает аэрацию и, в конечном итоге, способствует росту и цветению.

Потребность в N и P зависит от стадии роста, например, во время вегетативной фазы требуется больше азота, чем в продуктивной стадии, когда требуется фосфат.Микроэлементы, такие как Cu, Mg, Mn, B, Fe и Zn, вносятся дополнительно.

Доступно множество составов; однако чаще всего используется Ohio W.P. Состав такой. Также рекомендуется использование готовых препаратов, таких как NPK 20: 20: 20 или NPK 10: 30: 20 с микроэлементами вместе с кокосовой водой (20-25%).

Разведение орхидей :

В природе орхидеи опыляются насекомыми и птицами, и существует свободное скрещивание двух видов и двух родов.У видов и родов нет генетического барьера. Также существует полиплоидия и интрогрессивная гибридизация.

Важными родами, дающими максимальное количество искусственных гибридов, являются Cattleye, Cymbium, Paphiopedium, Vanda, Dendrobium и т. Д. Важными родовыми гибридами являются: Ascocenda (Ascocentrum × Vanda), Aranda (Arachnis × Vanda), Aeridovanda (Aerides × Ванда), Брассокаттлея (Brassovola × Cattleya), Saphrocattleya (Cattleya × Sophronities).

Некоторые важные гибриды, выведенные для выращивания срезанных цветов в промышленных масштабах, включают: Archianis —’Maggie Oei ‘, Aranthera — James Storie; Дендробиум — Пампадур, Уолтер Оум, Томи, Заклинание, Цезарь; Ванда — мисс Джо Аквим, Ротшильдиана Аскосенда Йе Сум Ва; Oncidium — Cymbidium — Babette (Mini), Ballerian (Mini), Broadmoor (Mini), Capella (Mini), Cassak (Mini), Cradle mont (Mini), Drumm (Mini), Fantasy (Mini), Green Queen (Mini). , Lime-light, Мэри Пинцесс, Мем Росл Грин, Миранда, Мем Росл Грин Лунное сияние, Pink Perfection, Princess Rose, Sabrina, Sir Cotton, Towiantot, Wendy Brown, Molly, Micke, Vanguard.Paphiopedium — King Arthur ‘Bougone’, амер. Hybr.Phalaenopsis — гибриды.

Вредители и болезни орхидей :

Орхидеи подвергаются нападениям различных видов вредителей, наиболее распространенными из которых являются тли, трипсы, мучнистые клопы, орхидеи-долгоносики, улитки и слизни. Они атакуют молодые побеги, листья и бутоны. Однако они эффективно контролируются с помощью обычных инсектицидов, таких как малатион или тиодан.

Орхидеи также подвержены многим грибковым, бактериальным и вирусным заболеваниям.Распространенными грибковыми заболеваниями являются пятнистость листьев, вызываемая Colletotrichum, sp. и Gleosporium, sp. фитофтороз, вызванный Pythium, sp. пятно на воротничке — вызванное Pencilliuthomii, и увядание орхидей, вызванное Sclerotium rolfsii, которое можно контролировать путем распыления фунгицидов, таких как Dithane M-45.

Система разведения и факторы, ограничивающие плодоношение орхидеи без нектара Broughtonia lindenii

Обычно считается, что низкие показатели завязываемости плодов у большинства орхидей (особенно эпифитных и тропических) являются следствием ограничений опыления и ограниченных ресурсов.В частности, ограничения опыления модулируются частотой посещений опылителей, поведением при посещении опылителей (способствующее скрещиванию или самоопылению), типом и количеством поллиний, отложившихся на рыльцах (в случае орхидей с почти одинаковыми поллиниями), и количеством пыльцы, загруженной на соцветие. Чтобы оценить, в какой степени эти факторы могут повлиять на завязывание плодов в конкретных системах орхидей-опылителей, было изучено влияние некоторых из этих аспектов на воспроизводство Broughtonia lindenii в прибрежной популяции на западе Кубы.Исследование было сосредоточено на системе селекции растений, важности содержания пыльцы и типа поллиний на последующих плодах и семенах, ограничивающих факторах производства семян и взаимодействии с опылителями. Этот вид представляет собой долговечные цветы, которые стареют после всех форм эффективного посещения. Была продемонстрирована зависимость от опылителей для производства фруктов, в то время как эксперименты по ручному опылению выявили самосовместимость и депрессию инбридинга на уровне семян. Большее количество поллиний на рыльцах увеличивает долю хорошо развитых семян.Напротив, тип поллинии, используемый при опылении, не важен для качества семян плодов, что позволяет предположить, что мелкие поллинии не являются рудиментарными. На естественное завязывание плодов в течение двух лет подряд существенное влияние оказывала деятельность опылителей, а также систематическая хищническая деятельность муравьев и гусениц. Учитывая, что у этой орхидеи полностью отсутствует нектар и что местное скопление опылителей и хищников повлияло на ее воспроизводство, незначительная важность ресурсных ограничений в этом эпифите (с долговременными резервными структурами) подтверждается, по крайней мере, на короткое время.

Текущий прогресс в исследованиях цветения орхидей / развития цветков

Сигнальное поведение растений. 2017; 12 (5): e1322245.

Hsin-Mei Wang

a Биотехнологический центр на юге Тайваня, Исследовательский центр сельскохозяйственной биотехнологии, Academia Sinica, Nankang, Тайбэй, Тайвань

Chii-Gong Tong

a Биотехнологический центр на юге Тайваня, Исследования в области сельскохозяйственных биотехнологий Center, Academia Sinica, Nankang, Taipei, Taiwan

Seonghoe Jang

a Биотехнологический центр на юге Тайваня, Исследовательский центр сельскохозяйственной биотехнологии, Academia Sinica, Nankang, Тайбэй, Тайвань

b Институт тропических растений, национальный Университет Ченг Кунг, Тайнань, Тайвань

a Биотехнологический центр на юге Тайваня, Исследовательский центр сельскохозяйственной биотехнологии, Academia Sinica, Нанкан, Тайбэй, Тайвань

b Институт тропических растений, Национальный университет Ченг Кунг, Тайнань, Тайвань

КОНТАКТЫ Seonghoe Jang вес[email protected], BCST ABRC, Academia Sinica, No. 59, Siraya Blvd., Xinshi Dist., Tainan 74145, Taiwan

Получено 7 апреля 2017 г .; Принято 19 апреля 2017 г.

Copyright © 2017 Taylor & Francis Group, LLC Эта статья цитируется в других статьях в PMC.

РЕФЕРАТ

Генетические пути, относящиеся к цветению Arabidopsis , находятся под контролем факторов окружающей среды, таких как продолжительность дня и температура, а также эндогенных сигналов, включая фитогормоны и возрастное старение.Однако гены и даже регуляторные пути цветения, идентифицированные у сельскохозяйственных культур, демонстрируют отклонение от таковых у Arabidopsis и часто не имеют функциональных эквивалентов Arabidopsis и / или существующих видоспецифичных регуляторов или родов, и демонстрируют модифицированные или новые пути.

Орхидеи — самые крупные, наиболее высокоразвитые цветковые растения, образующие весьма своеобразную группу растений. Здесь мы кратко суммируем пути цветения Arabidopsis , риса и пшеницы и представляем их вместе с недавними открытиями / прогрессом в цветении орхидей и процессами развития цветков, включая наши трансгенные орхидеи Phalaenopsis для сверхэкспрессии LEAFY .Возможные биотехнологические применения при цветении / цветении орхидей с потенциальными генами-мишенями также обсуждаются с точки зрения взаимодействия и / или сравнения.

КЛЮЧЕВЫЕ СЛОВА: Развитие цветов, цветение, орхидеи, биотехнология орхидей, трансформация орхидей

Важность перехода цветков в селекцию орхидей

Орхидеи — ценная цветоводческая культура, и некоторые дикие виды постоянно находятся под угрозой исчезновения из-за чрезмерного сбора для коммерческой торговли. 1 Крупные и сложные полиплоидные геномы, низкая эффективность трансформации, медленный рост и длительные жизненные циклы означают, что сложно преодолеть риск исчезновения или создать новые сорта, содержащие желаемые признаки, имеющие коммерческую ценность, с помощью традиционных методов селекции или генной инженерии. 2,3 Например, популярным сортам орхидей с высокой коммерческой ценностью (например, Phalaenopsis ) требуется более 2 лет, чтобы перейти от вегетативной фазы к репродуктивной. 3,4

Структура цветков орхидей имеет уникальное разнообразие среди цветковых растений. Более того, большинство орхидей определили благоприятные сезоны для цветения, а также соцветия и развития цветов. Хотя у орхидей было идентифицировано несколько генов, влияющих на развитие цветков, функция этих генов во время перехода орхидей к цветкам еще предстоит изучить путем создания надежных протоколов, чтобы вызвать изменения во времени цветения орхидей. 5,6,7 Молекулярные и генетические исследования цветения орхидей неоценимы не только для понимания молекулярных механизмов развития цветов, включая эволюционные тенденции, но и для помощи в молекулярной селекции для получения орхидей с желаемыми характеристиками.

Цветочный переход в модельном растении с длинным днем,

Arabidopsis

В Arabidopsis фотопериодическая информация для цветочного перехода определяется посредством взаимодействия циркадных часов и света.Оба эти фактора сходятся, чтобы регулировать экспрессию и активность фактора транскрипции CONSTANS (CO). 8 CO активирует ПОДАВЛЕНИЕ ПЕРЕЭКСПРЕССИИ КОНСТАНОВ1 ( SOC1 ) и APETALA1 ( AP1 ) через FLOWERING LOCUS T ( FT ) для стимулирования цветения. FT , кодирующий небольшой белок, который принадлежит к семейству фосфатидилэтаноламинсвязывающих белков (PEBP), экспрессируется в листьях, и полипептид перемещается в апикальную меристему побега и образует комплекс с фактором транскрипции bZIP, FD. 9,10 Впоследствии гены идентичности цветочной меристемы, такие как AP1, LEAFY ( LFY ), FRUITFULL ( FUL ) и CAULIFLOWER ( CAL ), индуцируются в цветочных меристемах, возникающих на бока верхушки побега. 10,11

Белок MADS-домена, FLOWERING LOCUS C (FLC) подавляет цветение, предотвращая транскрипцию FT в листьях и SOC1 и FD в верхушке побега. FRIGIDA ( FRI ) является положительным регулятором FLC . Однако механизмы опосредованной холодом репрессии, включая эпигенетические модификации и антисмысловую транскрипцию FLC , еще полностью не изучены. 12,13 Другие белки MADS, AGAMOUS-like19 (AGL19) и AGL24, тесно связанные с SOC1 и SHORT VEGETATIVE PHASE (SVP), соответственно, оказывают положительное влияние на цветение. Следует отметить, что их транскрипты накапливаются во время яровизации, и этот процесс, вероятно, не зависит от FLC . 14,15 Летний однолетник Arabidopsis может цвести без яровизации, но активное подавление цветения происходит при более низких температурах окружающей среды. FLOWERING LOCUS M ( FLM ) и SVP играют центральную роль в подавлении цветения при низкой температуре окружающей среды. В частности, FLM-β, альтернативно сплайсированная форма репрессора цветения FLM, взаимодействует с SVP, чтобы реагировать на изменения температуры окружающей среды, а SVP задерживает цветение, подавляя транскрипцию FT и SOC1 . 16 Следовательно, уменьшение количества репрессорных комплексов SVP-FLM-β при более высоких температурах приводит к цветению. 17 Распределение генов времени цветения у Arabidopsis показано на рис.

Основные гены цветения в фотопериодической и температурной сети Arabidopsis , риса, пшеницы и орхидей. (A) Цветению Arabidopsis способствуют длинные дни (LD). В каскаде световых сигналов задействованы GI и CO с модуляцией EARLY FLOWERING4 (ELF4) .ELF4 негативно регулирует экспрессию CO за счет секвестрации GI от промотора CO . CO положительно регулирует экспрессию цветочного интегратора FT , который опосредует активацию SOC1 . Ответ яровизации в Arabidopsis посредством белков семейства VERNALIZATION INSENSITIVE3 (VIN3) репрессирует членов семейства гена FLC , которые репрессируют FT и SOC1 . Кроме того, AGL24 участвует в FLC — независимом яровизированном ответе, чтобы регулировать экспрессию LFY .Температура окружающей среды влияет на время цветения в Arabidopsis через репрессорные комплексы SVP-FLM-β, которые задерживают цветение, подавляя транскрипцию FT и SOC1 при низкой температуре окружающей среды. (B) В рисе, растении короткого дня, хорошо сохраняется каскад OsGI Hd1 ( CO в Arabidopsis ) — Hd3a ( FT в Arabidopsis ). Hd1 и Ehd1 положительно регулируют Hd3a и способствуют цветению при индуктивных коротких днях (SDs).Однако при LDs Ghd7 является основным супрессором цветения, который репрессирует Ehd1 , а Hd1 также репрессирует экспрессию Hd3a . Вместо этого RFT1 активируется через OsMADS50 и Ehd1 для возможного цветения под LD. OsMADS50 и OsMADS56 действуют антагонистически, влияя на цветение под LD, контролируя экспрессию Ehd1 . Гомологи риса AP1 , такие как OsMADS14 и OsMADS15 , активируются флоригенами (например,g., Hd3a и RFT1) в SAM. (C) В пшенице ген TaFT1 / VRN3 объединяет фотопериод (через PPD1, WCO ) и яровизацию (через VRN1, VRN2 ). Фотопериодические сигналы с участием PPD1 передаются на отрицательный регулятор WCO1 и положительный регулятор TaHd1 для контроля экспрессии TaFT1 / VRN3 при SD. VRN2 предотвращает цветение до яровизации, но позже яровизация вызывает VRN1 , за которым следует подавление VRN2 , высвобождая TaFT1 / VRN3 , что приводит к цветению. ODDSOC2 ( TmOS2 / TaAGL33 ) функционирует как регулируемый яровизацией репрессор цветения. Он подавляется холодом независимо от VRN1 . (D) У орхидей Phalaenopsis PhalCOL и PaFT1 регулировались фотопериодом и низкой температурой окружающей среды, соответственно. Doritaenopsis DhEFL2, 3 и 4 в качестве репрессоров цветков координируют переход цветков в фотопериодическом пути цветения. DnVRN1 и DnFT из Dendrobium nobile связаны с цветочным переходом, индуцированным низкой температурой (10 ° C). Dendrobium Chao Praya Smile DOSOC1 специфически экспрессируется в цветочных меристемах во время перехода от вегетативной к репродуктивной фазе и в сочетании с активацией его LFY . DnAGL19 , экспрессия D . nobile , репрессированный комплексами поликомб-групп, активируется после яровизации, напоминая путь Arabidopsis AGL19 для активации LFY и AP1 для цветения.Стрелки и Т-образные столбики являются регуляторными звеньями для продвижения и подавления транскрипции генов соответственно. Цифры рядом со стрелками и Т-образными столбиками являются ссылками на соответствующие исследования, а пунктирные линии указывают на прогнозы сетей регулирования цветения. Прогнозирование сетей цветения орхидей должно быть подтверждено более обширными исследованиями.

Цветочный переход в модельном растении короткого дня, рис

Как показано на рисе, дата заголовка 3a (Hd3a) и ЛОКУС ЦВЕТАНИЯ РИСА T1 (RFT1) отвечают за индукцию цветков при коротком (SD) и длинном днях. -дневные (LD) условия соответственно. 18 Фактор транскрипции основного домена лейциновой молнии (bZIP), OsFD1, взаимодействует с Hd3a через 14–3–3 белков с образованием комплекса активации флоригена (FAC), действующего на индукцию OsMADS15 , ортолога AP1 риса. на верхушке побега во время индукции цветков. 19,20 Ранняя дата колошения 1 ( Ehd1 ) действует как активатор цветения, активируя Hd3a и RFT1 , а также контролирует архитектуру соцветий независимо от фотопериода. 21 Интересно, что Дата заголовка 1 ( Hd1 ), ортолог Arabidopsis CO риса имеет двойную функцию: он действует как активатор цветков, активируя Hd3a в условиях индуктивного SD, но превращается в репрессор Hd3a под длинными днями (LDs). 18,22 Число зерен, высота растения и дата заголовка 7 ( Ghd7 ) и Oryza sativa CONSTANS-LIKE4 ( OsCOL4 ) являются подавителями на входе Ehd1 , тогда как Oryza sativa INDETERMINATE1 ( Oryza sativa INDETERMINATE1 ( Oryza sativa) ) / Ehd2 / Rice INDETERMINATE1 ( RID1 ) и OsMADS50 , гомолог Arabidopsis SOC1 , являются активаторами Ehd1 (). 23 Другой ген MADS-бокса, OsMADS51 , функционирующий ниже Oryza sativa GIGANTEA ( OsGI ) в короткие дни (SD), способствует цветению, индуцируя экспрессию Ehd1 . Более того, Hd16 / RARLY FLOWERING1 ( EL1 ) действует как репрессор цветения, фосфорилируя Ghd7, что приводит к снижению экспрессии Ehd1 . Рис Ehd3 и Раннее цветение3 ( ELF3 ) также были идентифицированы как репрессоры Ghd7 . 22

Цветочный переход у сезонного цветущего растения, пшеницы

У пшеницы фактор транскрипции MADS-домена VERNALIZATION1 (VRN1), ортолог пшеницы Arabidopsis AP1 , является центральным регулятором цветения, вызванного яровизацией. 24 Специфический для травы ген MADS-box ODDSOC2 ( TmOS2 / TaAGL33 ) и его вариант сплайсинга TaAGL22 , ортологи FLC , подавляются холодом независимо от VRN1 , но VRN1 подавляет ODDSOC2 на стадии развития при ЛД и нормальной температуре. 25,26 VRN2, содержащий мотив цинкового пальца и CCT (CONSTANS, CO-like, TOC1) — домен, представляет собой репрессор цветения, подавляемый как яровизацией, так и SDs. 27 Холодные сигналы координированно активируют VRN1 и подавляют экспрессию VRN2 во время яровизации. Кроме того, VRN1 подавляет VRN2 , чтобы контролировать активность пути фотопериодического цветения (). VRN2 подавляет цветение при SDs и вызывает подавление VRN2 и усиление VRN1 и VRN3 после LD весной. VRN3 , ортолог Arabidopsis FT , является активатором цветения и также кодирует мобильный белок, который транспортируется от листьев к апикальной меристеме побегов (SAM). 28 Семейство регуляторов псевдоответа (PRR) PHOTOPERIOD1 ( PPD1 ) кодирует белковый домен CCT-домена, который влияет на чувствительность к длине дня, изменяя экспрессию CO -подобных генов: Wheat CO ( WCO1 ) отрицательно регулирует и Triticum aestivum HEADING DATE 1 ( TaHd1 ) положительно регулирует экспрессию VRN3 , связанную с поздним цветением в условиях SD. 29

Гены, контролирующие цветение у орхидей

Не так много сообщений о функциональных исследованиях генов цветения / развития цветков орхидей. Недавно было сообщено, что экспрессия Doritaenopsis hybrid EARLY FLOWERING4-like4 ( DhEFL4 ) регулируется фотопериодом, а сверхэкспрессия в Arabidopsis задерживает цветение. 30 Эктопическая экспрессия Phalaenopsis CO-like ( PhalCOL ), кодирующего белок с двумя B-боксными мотивами цинковых пальцев и доменом CCT в Phalaenopsis hybrida (cv.Wedding Promenade) вызвали фенотип раннего цветения у табака 31 и Phalaenopsis aphrodite FLOWERING LOCUS T1 ( PaFT1 ), который активируется при низкой индукционной температуре, но не подлежит фотопериодическому контролю, показал преждевременное цветение в Arabidopsis и рис при эктопическом выражении. 32 Более того, специфическая для флоэмы экспрессия PaFT1 в Arabidopsis подавляет эффект позднего цветения за счет активного аллеля FRI и сверхэкспрессии SVP .SVP образует комплекс с FLM, репрессором цветков FT , при температуре окружающей среды в Arabidopsis . 17 Фактор транскрипции bZIP-домена PaFD был выделен как белок, взаимодействующий с PaFT1 и способный частично комплементировать фенотип позднего цветения Arabidopsis fd-3 . 32 Онцидиум Gower Ramsey FLOWERING LOCUS T ( OnFT ) и TERMINAL FLOWER 1 ( OnTFL1 ), кодирующие гомологи активатора цветков FT и репрессора TERMINAL FLOWER1 (TFL1), соответственно, играют противоположные роли в Arabidopsis цветение. 33 Недавно сообщалось о Dendrobium nobile FLOWERING LOCUS T ( DnFT ) и MOTHER OF FT ( DnMFT ), экспрессируемых преимущественно во вспомогательных почках и листьях. Следует отметить, что экспрессия двух генов в листьях реагировала на температуру противоположным образом. Низкая температура (10 ° C), необходимая для цветения D. nobile Lindl: увеличивала экспрессию DnFT , но снижала экспрессию DnMFT . 34

Транскрипт гена идентичности меристемы цветков Phalaenopsis aphrodite LEAFY ( PhapLFY ) накапливается в зачатках меристемы цветков для стимуляции зарождения цветков.Также считается, что PhapLFY действует на ранних стадиях развития органов цветка. 35 Экспрессия DENDROBIUM ORCHID HOMEOBOX1 ( DOh2 ) из D . Madame Thong-In обнаруживается в зачатках листьев и подавляется на верхушке побега во время перехода цветков в качестве возможного вышестоящего регулятора DOMADS1 , экспрессируемого в апикальной меристеме переходного побега, ускоряя переход цветков и развитие цветков (). 36 О гомологах FLC не сообщалось, но гомологи Arabidopsis AGL19 были идентифицированы в D.nobile . Кроме того, экспрессия OncidiumMADS1 ( OMADS1 ), принадлежащего к группе генов MADS-бокса AP1 / AGL9 , обнаруживается в апикальной меристеме, а также в губах и плодолистиках цветков, а OMADS1 также взаимодействует с OMADS3, ассоциированным с с инициацией цветков Oncidium Gower Ramsey. 37 представляет собой краткое изложение современного понимания генов цветения орхидей, которые являются либо функциональными ортологами / гомологами Arabidopsis , генов риса и пшеницы.

Таблица 1.

Ключевые гены цветения орхидей.

f

f

Орхидеи Имя гена Регистрационный номер Гомолог a Ссылки b
Phalaenopsis Phalaenopsis 900 ent39 -nucleotide «,» attrs «: {» text «:» KJ609179 «,» term_id «:» 751414515 «}} KJ609179 Белок PaFT1 обнаружил 70%, 76% и 89% идентичности с Arabidopsis FT ({» type » : «entrez-protein», «attrs»: {«text»: «BAA77838», «term_id»: «42″}} BAA77838), рис Hd3a ({«type»: «entrez-protein», «attrs»: {«text»: «BAB61030», «term_id»: «14517624»}} BAB61030) и Oncidium orchid OnFT ({«type»: «entrez-protein», «attrs»: {«text»: «ACC59806 «,» term_id «:» 183228209 «}} ACC59806) соответственно. 32
Онцидиум OnFT {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KJ8″, «term_id»: «667673887»}} KJ8 кДНК OnFT кодирует белок из 176 аминокислот, который показывает 70% и 79% идентичности с Arabidopsis FT (AT1G65480) и Hd3a риса (Os06g0157700) соответственно. 33
Цимбидиум CgFT {«type»: «entrez-нуклеотид», «attrs»: {«text»: «HM120863», «term_id»: «330688014»}} HM120863 Белок CgFT составлял 94% с OnFT ({«type»: «entrez-нуклеотид», «attrs»: {«text»: «EU583502», «term_id»: «183228208»}} EU583502) из ​​ Oncidium Gower Ramsey, 79% с Hd3a ({«type»: «entrez-protein», «attrs»: {«text»: «BAB61028.1 «,» term_id «:» 14517620 «}} BAB61028.1) из Oryza sativa и 74% с FT ({» type «:» entrez-protein «,» attrs «: {» text «:» BAA77838 .1 «,» term_id «:» 42 «}} BAA77838.1) из Arabidopsis thaliana . 42
Cypripedium CfFT CFTC014733 частично выровнять по CTC014733 . и показал 82,58% идентичности с TaFT пшеницы ({«type»: «entrez-protein», «attrs»: {«text»: «ABK32205», «term_id»: «117168400»}} ABK32205). Orch
Phalaenopsis PaFD {«type»: «entrez-nucleotide», «attrs»: {«text»: «KJ609180», «term_id»: «751414517»}} KJ609180 PaFD показывает 34,7% идентичности с Arabidopsis FD (AT4G35900). 32
Dendrobium DnFD DNTC011756 Частичное DnFD выравнивает 169 аминокислот и обнаруживает 65,1% и 32,2% идентичности с Phaladeenopsis FD ({«type»: «nucleti «attrs»: {«text»: «KJ609180», «term_id»: «751414517»}} KJ609180) и Arabidopsis FD (AT4G35900) соответственно. Vect
Phalaenopsis PhalCOL {«type»: «entrez-нуклеотид», «attrs»: {«text»: «FJ469986», «term_id»: «242948873»} FJ469986 Белок PhalCOL показал 46% и 45% идентичности с COL4 арабидопсиса ({«type»: «entrez-protein», «attrs»: {«text»: «Q940T9», «term_id»: «52840166»}} Q940T9.2) и рис Hd1 ({«type»: «entrez-protein», «attrs»: {«text»: «ABB17664», «term_id»: «78058606»}} ABB17664) соответственно. 31
Cymbidium CeCOL CETC010739 Белок CeCOL показал 84.5%, 34,9% и 36,3% идентичности фаленопсису COL ({«type»: «entrez-nucleotide», «attrs»: {«text»: «FJ469986», «term_id»: «242948873»}} FJ469986), Arabidopsis CO (AT5G15840) и рис Hd1 (Os06g0275000) соответственно. Vect
Cypripedium CfFLC CFTC002458 Частичный CfFLC выровнял 145 аминокислот и показал 45,5% идентичности с FLC арабидопсиса (AT5G10140) и 41,2% с {TaAGL33 для пшеницы «entrez-protein», «attrs»: {«text»: «ABF57950», «term_id»: «95982258»}} ABF57950). Orch
Vect
Oncidium OgFLC OGTC046040 Частичное сопоставление OgFLC 145 аминокислот и выявление 44,8% идентичности с СЛЦ арабидопсиса (тип AT5G33101 и TaaG33%) с СЛЦ арабидопсиса (AT5G3310140) { «:» entrez-protein «,» attrs «: {» text «:» ABF57950 «,» term_id «:» 95982258 «}} ABF57950) .. Orch
Vect
Cypripedium CfVRN2 CFTC009002 Частичный CfVRN2 выровнял 106 аминокислот и показал 50% идентичность с VRN2 пшеницы ({«type»: «entrez-protein», «attrs»: {«text»: «AAS58481», «term_id»: «45357053»}} AAS58481). Orch
Phalaenopsis PmVRN2 PMTC002168 Частичный PmVRN2 выравнивает 142 аминокислоты и показывает 41,55% идентичности с VRN2 пшеницы ({«attrs-protein», «entrez type»: «entrez» : {«текст»: «AAS58481», «term_id»: «45357053»}} AAS58481). Orch
Dendrobium DOSOC1 {«type»: «entrez-nucleotide», «attrs»: {«text»: «KC121576», «term_id»: «482514619»}} KC121576 DOSOC1 имел 52% идентичности последовательности с Arabidopsis SOC1 (AT2G45660) и 57% идентичности с Oryza sativa OsSOC1 (Os03g0122600). 39
Phalaenopsis PlSOC1 PLTC039163 PlSOC1 на 87,9%, 48,4% и 54,3% идентичны Dendrobium ({«type»: «attdez-nucleus» {«text»: «KC121576», «term_id»: «482514619»}} KC121576), арабидопсис (AT2G45660) и рис (Os03g0122600) соответственно. Vect
Dendrobium DnAGL19 {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KU373056», «term_id»: «1005136636»} KU373056 Белок DnAGL19 на 48% идентичен AGL19 Arabidopsis (AT4G22950). 4
Онцидиум OnTFL1 {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KM233713», «term_id»: «} 699511715 KM233713 OnTFL1 кодирует белок из 173 аминокислот, который на 71% и 79% идентичен TFL1 арабидопсиса (AT5G03840) и OsFDR1 риса ({«type»: «entrez-нуклеотид», «attrs»: {«text»: «AF159883) «,» term_id «:» 5360179 «}} AF159883) соответственно. 33
Vanilloideae VpTFL1 VPTC023176 Частичный VpTFL1 выровнял 160 аминокислот и показал 81.8%, 69,9% и 83,6% идентичности Oncidium TFL1 ({«type»: «entrez-нуклеотид», «attrs»: {«text»: «KM233713», «term_id»: «699511715»}} KM233713), TFL1 арабидопсиса (AT5G03840) и FDR1 риса ({«type»: «entrez-нуклеотид», «attrs»: {«text»: «AF159883», «term_id»: «5360179»}} AF159883) соответственно. Vect
Cymbidium CfAPl1 {«type»: «entrez-nucleotide», «attrs»: {«text»: «JQ031272.1», «term_id»: «372121979 }} JQ031272.1 CfAPl1 имеет 45% идентичность последовательности с AP1 Arabidopsis (AT1G69120) и 52% идентичности с Oryza sativa OsMADS14 (Os03g0752800). 43
Phalaenopsis PsAP1 PSTC034274 Белок PsAP1 показал 55,8%, 47,6% и 58,3% идентичности Cymbidium AP11 ({«type» ядер AP11 ({«type» «: {» text «:» JQ031272.1 «,» term_id «:» 372121979 «}} JQ031272.1), Arabidopsis AP1 (AT1G69120) и рис MADS14 (Os03g0752800) соответственно. Vect
Doritaenopsis DnVRN1 DNTC013820 Частичный DnVRN1 выровнял 251 аминокислоту и показал 61.75% идентичности пшенице VRN1 ({«type»: «entrez-protein», «attrs»: {«text»: «AAZ76881», «term_id»: «73533616»}} AAZ76881). Orch
Phalaenopsis PaVRN1 PATC201550 Частичное выравнивание PaVRN1 по 250 аминокислотам показало 60,4% идентичности с VRN1 пшеницы ({«type»: «entre attrs-protein» : {«текст»: «AAZ76881», «term_id»: «73533616»}} AAZ76881). Orch
Cymbidium ChLFY {«type»: «entrez-protein», «attrs»: {«text»: «AGE45851», «term_id»: «448872323»}} AGE45851 Белок ChLFY показал 51% и 48% идентичности с LFY Arabidopsis (AT5G61850) и RFL риса (Os04g0598300), соответственно. Vect
Phalaenopsis PhalLFY {«type»: «entrez-nucleotide», «attrs»: {«text»: «FJ469985», «term_id»: «} 242948843 FJ469985 Белок PhalLFY на 60% идентичен RFL риса ({«type»: «entrez-protein», «attrs»: {«text»: «BAA21547», «term_id»: «2274790»}} BAA21547), 54 % идентичности с LFY Arabidopsis ({«type»: «entrez-protein», «attrs»: {«text»: «NP_200993», «term_id»: «15240366»}} NP_200993) и высокой идентичности с LFY (68 % и 67%) от Anacamptis ({«type»: «entrez-protein», «attrs»: {«text»: «BAC55081», «term_id»: «27544590»}} BAC55081) и Orchis ({«type» : «entrez-protein», «attrs»: {«text»: «BAC54955», «term_id»: «27544437»}} BAC54955) соответственно. 44
Phalaenopsis PhapLFY {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KP893636», «term_id»: «948539853» KP893636 Белок PhapLFY на 78,5% идентичен ChLFY ({«type»: «entrez-protein», «attrs»: {«text»: «AGE45851», «term_id»: «448872323»}} AGE45851), Cymbidium гомолог LFY орхидеи, 53,2% идентичности RFL ({«type»: «entrez-protein», «attrs»: {«text»: «BAA21547», «term_id»: «2274790»}} BAA21547), гомолог LFY риса , и 47.0% идентичности Arabidopsis LFY ({«type»: «entrez-protein», «attrs»: {«text»: «AAM27941», «term_id»: «20563243»}} AAM27941). 35
Doritaenopsis DhEFL2 {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KP728997», «term_id»: «} 765488080 KP728997 Гомологи DhEFL показали, что DhEFL4 ({«type»: «entrez-нуклеотид», «attrs»: {«text»: «KP010003», «term_id»: «746818096»}} KP010003) и DhEFL2 ({«type «:» entrez-нуклеотид «,» attrs «: {» text «:» KP728997 «,» term_id «:» 765488080 «}} KP728997) аналогичны с 72% идентичными аминокислотами, тогда как DhEFL3 ({» type «:» entrez-nucleotide «,» attrs «: {» text «:» KP728998 «,» term_id «:» 765488088 «}} KP728998) расходится с 72% сходства с DhEFL2 и 68% схожести с DhEFL4. 45
Doritaenopsis DhEFL3 {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KP728998», «term_id»: «} 765488088 KP728998 Белок DhEFL3 показал 31,4% идентичности с ELF4 арабидопсиса (AT2G40080). Vect
Doritaenopsis DhEFL4 {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KP010003», «term_id»: «} 746818096 KP010003 Белок DhEFL4 показал 37% идентичности с ELF4 арабидопсиса (AT2G40080). Vect
Phalaenopsis PsEhd1 PSTC018079 Частичный PsEhd1 выравнивает 266 аминокислот и показывает 40% идентичность с Ehd1 риса (Os10g0463400). Orch
Cymbidium CsEhd1 CSTC008880 Частичный CsEhd1 выравнивает 263 аминокислоты и показывает 49,5% идентичности с Ehd1 риса (Os10g0463400). Орхидея

Стратегии разведения орхидей

Обычно орхидеи растут медленно и имеют длительный жизненный цикл.Следовательно, для создания новых сортов с использованием традиционного процесса селекции требуется длительный период времени. Технология трансформации была разработана для орхидей, и недавно было продемонстрировано несколько успешных методов 38,39 , в которых используется вирус-индуцированное подавление генов (VIGS), как эффективных стратегий для функциональных исследований генов у орхидей. 40 Таким образом, теперь мы можем ускорить процесс селекции орхидей, подавив экспрессию цветочных репрессоров, приводящую к раннему цветению.Кроме того, подходы к вирус-индуцированному цветению (VIF) для ускорения перехода к репродуктивному росту могут облегчить исследования и / или разведение орхидей. 41 Например, усиление функции FT или потеря функции TFL1 с использованием временных методов, таких как VIGS / VIF, могут способствовать более быстрому процессу разведения орхидей. Используя индуцибельные системы экспрессии генов, мы можем рассчитывать контролировать цветение орхидей с помощью трансгенных линий независимо от окружающей среды. 32 Специфические аллели могут быть отобраны для селекции и / или модифицированы путем индуцированной мутации (редактирования генома) для приобретения сортов орхидей, содержащих желаемые признаки, когда текущие процедуры трансформации стабилизируются. 11 В наших недавних отчетах мы показали, что VIGS PaFT1 демонстрирует отложенный всплеск P. aphrodite subsp. Цветки formosana и VIGS- PhapLFY показали повышенное содержание хлорофилла с аномальной формой эпидермальных клеток. 32,35 Кроме того, мы успешно получили трансгенный Phalaenopsis для сверхэкспрессии PhapLFY ().

Сверхэкспрессия PhapLFY в Phalaenopsis. (A) Конструирование плазмиды для сверхэкспрессии PhapLFY в орхидеях Phalaenopsis . p Ubiq означает промотор убиквитина кукурузы, а T означает терминатор . RB и LB указывают правую и левую границы Т-ДНК. Кассету экспрессии гигромицинфосфотрансферазы II ( hptII ) использовали для определения устойчивости к гигромицину при селекции трансгенных орхидей.(B) Трансгенные орхидеи Phalaenopsis , сверхэкспрессирующие ген PhapLFY . Каждый саженец трансгенной орхидеи использовали для анализа на С (слева) и молодые саженцы орхидеи. Штанга = 2 см. (C) Проверка трансгенных орхидей Phalaenopsis с помощью геномной ПЦР и ОТ-ПЦР. Экспрессию PhapLFY и гена устойчивости к гигромицину ( hptII ) исследовали с помощью ОТ-ПЦР вместе с 18s рРНК в листьях каждого растения. Расположение праймеров, используемых для геномной ПЦР, припарковано в (A).P указывает на плазмидную ДНК, используемую для трансформации в качестве положительного контроля для ПЦР, а WT указывает на нетрансгенную орхидею Phalaenopsis на той же стадии развития, что и трансгенные орхидеи. JIT6: 5’TTGTCGATGCTCACCCTG3 ‘, JIT841: 5’CTAGCCGCTCCTCTCTGTCTCCGAC3’, PhapLFY -F: 5’GAGGAGGAGGTGGACGATATGATG3 ‘, PhapLFY -R: 5’GCTTGTTTATGTAGCTTGCTCCTAC3′, hptII -F: 5’GATTCCGGAAGTGCTTGACATTG3 ‘, hptII -R: 5’GCATCAGCTCATCGAGAGCCTG3 ‘, 18S рРНК -F: 5’TTAGGCCACGGAAGTTTGAGG3′, 18S рРНК -R: 5’ACACTTCACCGGACCATTCAA3 ‘.

Заключение и направления на будущее

Orchidaceae — самое большое и самое разнообразное семейство цветковых растений, и у большинства орхидей есть свои сезоны цветения: D . nobile требует яровизации для цветения, тогда как D . Фаленопсис цветет при высоких температурах. Шип P . aphrodite subsp formosana значительно ингибируется в теплых условиях во время естественного периода цветения P . sanderiana — все лето на Филиппинах. Молекулярные механизмы, лежащие в основе цветения различных видов орхидей, в значительной степени остаются неуловимыми. Исследования цветения с целью вызвать раннее цветение у орхидей были направлены не только на лучшее понимание молекулярных и генетических механизмов цветения орхидей, но и на помощь программам разведения орхидей. 1 На цветение in vitro или переход цветков орхидей влияют различные регуляторы роста растений (PGR), хотя молекулярные рабочие механизмы этих PGR, лежащих в основе индукции цветков орхидей, неясны.Молекулярно-генетические подходы необходимы, чтобы пролить свет на роль предполагаемых ключевых генов цветения орхидей, а также обеспечить платформу для применения генетических ресурсов в индустрии орхидей.

Раскрытие информации о потенциальных конфликтах интересов

О потенциальных конфликтах интересов не сообщалось.

Благодарность

Мы благодарим г-жу Миранду Лони за помощь с редактированием на английском языке.

Финансирование

Эта работа была частично поддержана основным грантом BCST ABRC, Academia Sinica, Тайвань.

Ссылки

1. Хоссейн М.М., Кант Р., Ван П.Т., Винарто Б., Зенг С., Тейшейра да Силва Ж.А.
Применение биотехнологии к орхидеям. Критик Rev Plant Sci
2013; 32: 69-139; https://doi.org/10.1080/07352689.2012.715984 [CrossRef] [Google Scholar] 2. Pan IC, Liao DC, Wu FH, Daniell H, Singh ND, Chang C, Shih MC, Chan MT, Lin CS.
Полная последовательность хлоропластного генома кандидата в модельные растения орхидеи: Erycina pusilla применяется в тропическом разведении Oncidium . PLoS One
2012; 7: e34738; PMID: 22496851; https: // doi.org / 10.1371 / journal.pone.0034738 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 3. Лу ХК, Чен ХХ, Цай У.С., Чен ХХ, Су ХД, Чанг CN, Йе ХХ.
Стратегии функциональной проверки генов, участвующих в репродуктивных стадиях орхидей. Физиология растений
2007; 143: 558-69; PMID: 17189336; https://doi.org/10.1104/pp.106.092742 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 4. Лян С., Йе QS, Ли РХ, Ленг Дж.Й., Ли М.Р., Ван XJ, Ли Штаб.
Регуляция транскрипции индуцированного низкой температурой перехода цветков у видов Orchidaceae , Dendrobium nobile : анализ меток экспрессии последовательностей.Comp Funct Genomics
2012; 2012: 757801; PMID: 22550428; https://doi.org/10.1155/2012/757801 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 5. Су CL, Chen WC, Lee AY, Chen CY, Chang YC, Chao YT, Shih MC.
Модифицированная модель цветения орхидей ABCDE, основанная на исследованиях профилей экспрессии генов орхидеи-бабочки Phalaenopsis aphrodite . PLoS One
2013; 8: e80462; PMID: 24265826; https://doi.org/10.1371/journal.pone.0080462 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 6. Hsu HF, Hsu WH, Lee YI, Mao WT, Yang JY, Li JY, Yang CH..
Модель формирования околоцветника у орхидей. Нат завод
2015; 1: 15046; https://doi.org/10.1038/nplants.2015.46 [CrossRef] [Google Scholar] 7. Харилло Х.А., Пиньейро М.
Время — это все в развитии растений. Центральная роль цветочных репрессоров. Растениеводство
2011; 181: 364-78; PMID: 21889042; https://doi.org/10.1016/j.plantsci.2011.06.011 [PubMed] [CrossRef] [Google Scholar] 8. Дойл М.Р., Дэвис С.Дж., Бастоу Р.М., МакВаттерс Г.Г., Козма-Богнар Л., Надь Ф., Миллар А.Дж., Амасино Р.М.
Ген ELF4 контролирует циркадные ритмы и время цветения у Arabidopsis thaliana .Природа
2002; 419: 74-77; PMID: 12214234; https://doi.org/10.1038/nature00954 [PubMed] [CrossRef] [Google Scholar] 9. Терк Ф., Форнара Ф., Коупленд Дж.
Регулирование и идентичность florigen: FLOWERING LOCUS T занимает центральное место. Энн Рев Плант Биол
2008; 59: 573-94; PMID: 18444908; https://doi.org/10.1146/annurev.arplant.59.032607.092755 [PubMed] [CrossRef] [Google Scholar] 10. Юнг Ч., Мюллер А.Е. «Контроль времени цветения и применение в селекции растений». Тенденции Plant Sci
2009; 14: 563-73; PMID: 19716745; https: // doi.org / 10.1016 / j.tplants.2009.07.005 [PubMed] [CrossRef] [Google Scholar] 11. Парси Ф.
Цветение: время интеграции. Инт Дж Дев Биол
2005; 49: 585-93; PMID: 16096967; https://doi.org/10.1387/ijdb.041930fp [PubMed] [CrossRef] [Google Scholar] 12. Хелливелл, Калифорния, Андерссен Р.С., Робертсон М., Финнеган Э.Дж.
Как подавление FLC инициируется холодом?
Тенденции Plant Sci
2015; 20: 76-82; PMID: 25600480; https://doi.org/10.1016/j.tplants.2014.12.004 [PubMed] [CrossRef] [Google Scholar] 13. Буше Ф, Вудс Д, Амасино РМ.Зимняя память во всем царстве растений: разные пути к цветению. Физиология растений
2017; 173: 27-35; PMID: 27756819; https://doi.org/10.1104/pp.16.01322 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 14. Schönrock N, Bouveret R, Leroy O, Borghi L, Köhler C, Gruissem W, Hennig L.
Белки группы поликомб репрессируют активатор цветков AGL19 в FLC -независимом пути яровизации. Genes Dev
2006; 20: 1667-78; PMID: 16778081; https://doi.org/10.1101/gad.377206 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 15.Блюмел М., Далли Н., Юнг К.
Регулирование времени цветения сельскохозяйственных культур — чему мы научились у арабидопсиса?
Curr Opin Biotechnol
2015; 32: 121–29; PMID: 25553537; https://doi.org/10.1016/j.copbio.2014.11.023 [PubMed] [CrossRef] [Google Scholar] 16. Джанг С., Торти С., Коупленд Г.
Генетические и пространственные взаимодействия между FT, TSF и SVP на ранних стадиях индукции цветков у Arabidopsis. Завод J
2009; 60: 614-25; PMID: 19656342; https://doi.org/10.1111/j.1365-313X.2009.03986.x [PubMed] [CrossRef] [Google Scholar] 17. Ли JH, Ryu HS, Chung KS, Posé D, Kim S, Schmid M, Ahn JH.
Регулирование чувствительного к температуре цветения репрессорами фактора транскрипции MADS-бокса. Наука
2013; 342: 628-32; PMID: 24030492; https://doi.org/10.1126/science.1241097 [PubMed] [CrossRef] [Google Scholar] 18. Комия Р., Ёкои С., Шимамото К.
Генная сеть для цветения длинного дня активирует RFT1, кодирующий мобильный сигнал цветения риса. Разработка
2009; 136: 3443-50; PMID: 19762423; https: // doi.org / 10.1242 / dev.040170 [PubMed] [CrossRef] [Google Scholar] 19. Таока К., Оки И., Цудзи Х., Кодзима К., Симамото К.
Структура и функции флоригена и рецепторного комплекса. Тенденции Plant Sci
2013; 18: 287-94; PMID: 23477923; https://doi.org/10.1016/j.tplants.2013.02.002 [PubMed] [CrossRef] [Google Scholar] 20. Тамаки С., Цудзи Х., Мацумото А., Фудзита А., Шиматани З., Терада Р., Сакамото Т., Курата Т., Симамото К.
FT-подобные белки индуцируют молчание транспозонов на верхушке побега во время индукции цветков риса.Proc Natl Acad Sci USA
2015; 112: E901-10; PMID: 25675495; https://doi.org/10.1073/pnas.1417623112 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 21. Эндо-Хигаси Н., Идзава Т.
Гены времени цветения Дата заголовка
1 и Ранняя дата товарной позиции 1 вместе контролируют развитие метелки у риса. Физиология растительной клетки
2011; 52: 1083-94; PMID: 21565907; https://doi.org/10.1093/pcp/pcr059 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 22. Sun C, Chen D, Fang J, Wang P, Deng X, Chu C.Понимание генетической и эпигенетической архитектуры в сложной сети путей цветения риса. Белковая клетка
2014; 5: 889-98; PMID: 25103896; https://doi.org/10.1007/s13238-014-0068-6 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 23. Чой С.К., Ли С., Ким С.Р., Ли Ю.С., Лю Си, Цао Икс, Ан Г.
Белок группы Trithorax Oryza sativa Trithorax1 контролирует время цветения риса посредством взаимодействия с ранней датой колошения3. Физиология растений
2014; 164: 1326-37; PMID: 24420930; https://doi.org/10.1104/pp.113.228049 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 24. Ян Л., Лукоянов А., Транквилли Г., Хельгера М., Фахима Т., Дубцовский Дж.
Позиционное клонирование гена яровизации пшеницы VRN1 . Proc Natl Acad Sci USA
2003; 100: 6263-68; PMID: 12730378; https://doi.org/10.1073/pnas.0937399100 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 25. Greenup AG, Сасани С., Оливер С.Н., Талбот М.Дж., Деннис Э.С., Хемминг М.Н., Треваскис Б.
ODDSOC2 — это цветочный репрессор MADS box, который подавляется яровизацией в зерновых культурах умеренного пояса.Физиология растений
2010; 153: 1062-73; PMID: 20431086; https://doi.org/10.1104/pp.109.152488 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 26. Шарма Н., Рюленс П., Дхау М., Магген Т., Дочи Н., Торфс С., Кауфманн К., Роде А., Гойтен К.
Гомолог цветущего локуса C является репрессором, регулируемым яровизацией, у Brachypodium и регулируется холодом у пшеницы. Физиология растений
2017; 173: 1301-15; PMID: 28034954; https://doi.org/10.1104/pp.16.01161 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 27. Ян Л., Лукоянов А., Блечл А., Транкуилли Дж., Рамакришна В., Сан Мигель П., Беннетцен Дж. Л., Эченик В., Дубковски Дж.Ген пшеницы VRN2 представляет собой репрессор цветения, подавляемый яровизацией. Наука
2004; 303: 1640-44; PMID: 15016992; https://doi.org/10.1126/science.1094305 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 28. Yan L, Fu D, Li C, Blechl A, Tranquilli G, Bonafede M, Sanchez A, Valarik M, Yasuda S, Dubcovsky J.
Ген яровизации пшеницы и ячменя VRN3 является ортологом FT . Proc Natl Acad Sci USA
2006; 103: 19581-86; PMID: 17158798; https: // doi.org / 10.1073 / pnas.0607142103 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 29. Китагава С., Шимада С., Мураи К.
Влияние Ppd-1 на экспрессию генов времени цветения на вегетативной и репродуктивной стадиях роста пшеницы. Гены Genet Syst
2012; 87: 161-68; PMID: 22976391; https://doi.org/10.1266/ggs.87.161 [PubMed] [CrossRef] [Google Scholar] 30. Чэнь В., Цинь Ц., Чжэн И, Ван Ц., Ван С., Чжоу М., Чжан Ц., Цуй Ю.
Сверхэкспрессия гибрида Doritaenopsis E ARLY FLOWERING 4-like4 гена, DhEFL4 , откладывает цветение у трансгенного Arabidopsis .Завод Мол Биол Реп
2016; 34: 103-17; https://doi.org/10.1007/s11105-015-0899-1 [CrossRef] [Google Scholar] 31. Чжан Дж. Х, Ву К. Л., Тиан Л. Н., Цзэн С. Дж., Дуань Дж.
Клонирование и характеристика нового гена, подобного CONSTANS , из Phalaenopsis hybrida . Завод Acta Physiol
2011; 33: 409-17; https://doi.org/10.1007/s11738-010-0560-4 [CrossRef] [Google Scholar] 32. Jang S, Choi SC, Li HY, An G, Schmelzer E.
Функциональная характеристика Phalaenopsis aphrodite цветковых генов PaFT1 и PaFD.PLoS One
2015; 10: e0134987; PMID: 26317412; https://doi.org/10.1371/journal.pone.0134987 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 33. Хоу СиДжей, Ян Ч.
Функциональный анализ ортологов FT и TFL1 орхидеи ( Oncidium, Gower Ramsey), регулирующих вегетативный переход к репродуктивному. Физиология растительной клетки
2009; 50: 1544-57; PMID: 19570813; https://doi.org/10.1093/pcp/pcp099 [PubMed] [CrossRef] [Google Scholar] 34. Ли Р., Ван А., Сунь С., Лян С., Ван Х, Е Цюй, Ли Х.
Функциональная характеристика генов ортологов FT и MFT у орхидей ( Dendrobium nobile Lindl), которые регулируют переход от вегетативного к репродуктивному этапам у Arabidopsis .Культ растительных клеток, тканей, органов
2012; 111: 143-51; https://doi.org/10.1007/s11240-012-0178-x [CrossRef] [Google Scholar] 35. Чан С.
Функциональная характеристика PhapLEAFY, ортолога FLORICAULA / LEAFY в Phalaenopsis aphrodite . Физиология растительной клетки
2015; 56: 2234-47; PMID: 26493518; https://doi.org/10.1093/pcp/pcv130 [PubMed] [CrossRef] [Google Scholar] 36. Ю Х, Ян Ш., Го Си Джей.
DOh2, ген knox класса 1, необходим для поддержания базовой архитектуры растений и цветочных переходов у орхидей.Растительная клетка
2000; 12: 2143-59; PMID: 110; https://doi.org/10.1105/tpc.12.11.2143 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 37. Hsu HF, Huang CH, Chou LT, Yang CH.
Внематочная экспрессия AGL6-подобного гена орхидеи (Oncidium Gower Ramsey) способствует цветению путем активации генов времени цветения в Arabidopsis thaliana . Физиология растительной клетки
2003; 44: 783-94; PMID: 12941870; https://doi.org/10.1093/pcp/pcg099 [PubMed] [CrossRef] [Google Scholar] 38. Thiruvengadam M, Chung IM, Yang CH.Сверхэкспрессия гена Oncidium MADS (OMADS1) способствует раннему цветению трансгенной орхидеи ( Oncidium Gower Ramsey). Завод Acta Physiol
2012; 34: 1295-02; https://doi.org/10.1007/s11738-012-0926-x [CrossRef] [Google Scholar] 39. Дин Л., Ван И, Ю Х.
Сверхэкспрессия DOSOC1, ортолога SOC1 Arabidopsis, способствует цветению орхидеи Dendrobium Chao Parya Smile. Физиология растительной клетки
2013; 54: 595-608; PMID: 23396600; https://doi.org/10.1093/pcp/pct026 [PubMed] [CrossRef] [Google Scholar] 40.Лу ХК, Чен ХХ, Цай У.С., Чен ХХ, Су ХДЖ, Чанг DCN, Йе ХХ.
Стратегии функциональной проверки генов, участвующих в репродуктивных стадиях орхидей. Физиология растений
2007; 143: 558-69; PMID: 17189336; https://doi.org/10.1104/pp.106.092742 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 41. McGarry RC, Klocko AL, Pang M, Strauss SH, Ayre BG.
Цветение, индуцированное вирусами: применение репродуктивной биологии в пользу исследований и селекции растений. Физиология растений
2017; 173: 47-55; PMID: 27856915; https: // doi.org / 10.1104 / pp.16.01336 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 42. Хуанг В., Фанг З., Цзэн С., Чжан Дж., Ву К., Чен З., Тейшейра да Силва Дж. А., Дуан Дж.
Молекулярное клонирование и функциональный анализ трех гомологичных генов FLOWERING LOCUS T ( FT ) из китайского Cymbidium . Int J Mol Sci
2012; 13: 11385-98; PMID: 23109860; https://doi.org/10.3390/ijms130

5 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 43. Тиан И, Юань Х, Цзян С., Цуй Б., Су Дж.Молекулярное клонирование и пространственно-временная экспрессия APETALA1 / FRUITFULL -подобного гена MADS -box орхидеи ( Cymbidium faberi ). Шэн У Гонг Ченг Сюэ Бао
2013; 29: 203-13; PMID: 23697165.

Оставьте комментарий