Разновидности хост: Виды и Сорта, Посадка и Уход (120+ Фото) +Отзывы

Содержание

Виды и Сорта, Посадка и Уход (120+ Фото) +Отзывы

ЭкономияSavedRemoved 3

За хостой давно закрепилось почетное звание «королевы тенистого сада». И это неслучайно: неприхотливый декоративный многолетник великолепно чувствует себя на тенистых участках под деревьями, где зачастую не растут никакие другие растения.

Мы расскажем о разновидностях хосты и самых популярных сортах, о посадке этого растения в открытый грунт, условиях выращивания и уходе за ним, а также о способах размножения и использовании хосты в ландшафтном дизайне.

Читайте также: Хлорофитум домашний (120 Фото) – уход в домашних условиях, размножение, пересадка, болезни +Отзывы

Описание

Хоста – это многолетнее декоративно-лиственное растение. Его родина – Дальний Восток, Япония, Китай и страны Юго-Восточной Азии, где эти красивые кусты растут в естественных условиях.

Ранее это растение и род в целом носили название Функия, которое было присвоено в честь немецкого ботаника Генриха Кристиана Функа, жившего в XVIII – XIX вв.

В ландшафтном дизайне

Затем и сам многолетник, и весь род были официально переименованы: такое решение приняли участники Международного Ботанического конгресса, проходившего в 1905 году.

Свое новое название растение получило в честь Николауса Томаса Хоста – австрийского доктора и ботаника. В настоящее время род Хоста относится к семейству Спаржевые, хотя ранее он принадлежал семейству Лилейные.

Хосты зацветают в июле-августе. В это время на кустах распускаются многочисленные цветки воронковидной или колокольчатой формы. Они напоминают небольшие лилии, возвышаются над кустами на длинных цветоносах и издают тонкий аромат. Существуют сорта с белыми, сиреневыми и нежно-лиловыми оттенками лепестков.

Цветки растения

1Цветки, выглядят достаточно скромно, а основным украшением этого растения является его роскошная листва.

2Листья, сидящие на черешках, формируют прикорневую розетку. У разных сортов листья различны по фактуре, форме и расцветке. Они могут быть узколанцетовидными и широкояйцевидными, однотонными и пестрыми, иметь всевозможные оттенки зеленого и голубого цвета.

Хосты – настоящие долгожители среди всех травянистых многолетних растений, они живут до 25 лет!

Аккуратные кустики с листьями, фигурно выложенными в своеобразную «прическу», с возрастом становятся все более пышными и очень долгое время сохраняют свою декоративность. Они применяются для создания бордюров, а их листья используются также при составлении букетов и цветочных аранжировок.

Читайте также: Ландшафтный дизайн вашего участка своими руками – (130+ Фото идей & Видео) +Отзывы

Разновидности

В Европу хосты были привезены из Японии в XVIII—XIX веках, и с тех пор они выращиваются в культуре. По высоте (без учета цветоносов) эти декоративные многолетники делятся на шесть групп.

При этом не существует строгих международных стандартов отнесения определенного сорта к той или иной группе. Они могут отличаться в разных странах и даже у различных поставщиков.

В среднем, все хосты делятся на:

  • миниатюрные (достигают в высоту чуть более 10 см)
  • карликовые (10-15 см)
  • низкорослые (15-35 см)
  • среднерослые (35-55 см)
  • высокорослые (55-75 см)
  • гигантские (75-150 см)

Род Хоста насчитывает более двух десятков видов. При этом некоторые из них существуют только в культуре, а в естественных условиях произрастания не встречаются.

Наиболее распространены и популярны следующие виды:

Волнистая хоста

Волнистая хоста

Растение с листьями, имеющими длину до 20 см, удлиненную форму и волнистые края.

В расцветке листьев белые участки перемежаются с зелеными, а лепестки цветков окрашены в светло-фиолетовый оттенок.

Хоста Зибольда

Хоста Зибольда

Растение с плотными широкими листьями до 30 см длиной, покрытыми сизым восковым налетом. Соцветия короткие и плотные, цветки бледно-лиловой или светло-фиолетовой расцветки. На солнце листья этого вида теряют свой сизый оттенок и становятся зелеными.

Этот вид назван в честь Филиппа Франца фон Зибольда – немецкого естествоиспытателя и коллекционера растений. Он какое-то время жил в Японии в XIX веке и изучал ее животный и растительный мир. Кроме хосты имя Зибольда носят еще несколько десятков японских растений.

Хоста ланцетолистная

Хоста ланцетолистная

Растение родом из Северо-Восточного Китая и юга Приморья.

Удлиненные ланцетные листья имеют длину до 25 см и образуют компактный куст, а на цветоносах высотой до 100 см в июле-августе распускаются многочисленные лиловые цветки. Кусты растут быстро.

Подорожниковая хоста

Подорожниковая хоста

Растение родом из Японии и Китая. Округлые листья до 40 см длиной, окрашенные в ярко-зеленый цвет, образуют крупную «подушку», которая возвышается над цветником.

В августе появляются цветоносы до 100 см высотой с трубчатыми цветками.

Хоста Форчуна

Хоста Форчуна

Во многом схожа с хостой Зибольда, но имеет меньшие размеры и меньший восковой налет на листьях. К этому виду относятся сорта, различные по окраске и размеру листьев, оттенку цветков и высоте цветоносов. Садовые формы этой хосты достаточно неприхотливы и могут расти только в умеренных широтах.

Вид назван в честь ботаника из Великобритании Роберта Форчуна. В середине XIX века он совершил несколько продолжительных путешествий по Китаю, Японии и Тайваню, собирая неизученные и неизвестные в Европе растения.

Хоста белоокаймленная

Хоста белоокаймленная

Формирует плотную розетку листьев и цветет в июле-августе. Кусты некрупные, хорошо могут расти в контейнере.

Существует большое количество сортов этого вида с зелеными, желто-зелеными, темно-зелеными и сине-зелеными гофрированными листьями, имеющими тонкую белую кайму по краю.

Хоста прямолистная

Хоста прямолистная

Мощное растение с практически вертикально растущими листьями на длинных черешках. В диком виде встречается в Японии, на Сахалине и Курильских островах.

В Стране восходящего солнца это растение считается съедобным и даже лекарственным. Оно находит применение во многих рецептах японской народной медицины.

Хоста вздутая

Хоста вздутая

Растение с широкими сердцевидными листьями. Образует мощный куст, достигающий 80 см как в высоту, так и в ширину. Сиреневые цветки распускаются на длинных (120 см) цветоносах в июле-августе.

Этот вид имеет много сортов с самой разнообразной окраской листьев и цветков.

Читайте также: Проекты дачных домиков для 6-10 соток: 120 фото, описание и требования | Самые интересные идеи

Сорта

На сегодняшний день известно порядка 600 сортов хосты. Каждый год регистрируются десятки новых сортов, среди которых немало удивительных и действительно роскошных. Мы познакомим вас с самыми красивыми, популярными и необычными сортами, которые могут занять достойное место в вашем саду.

Blue Angel (Голубой ангел)

Blue Angel (Голубой ангел)

Гигантский сорт с изящными сине-зелеными листьями, ниспадающими красивым каскадом. Высота кустов составляет 100-120 см. Цветки лавандового цвета.

Сорт теневынослив, может выдержать лишь утреннее солнце.

Albomarginata

Blue Angel (Голубой ангел)

Очаровательный сорт среднего размера с плотной розеткой листьев. Кусты раскидистые, высотой и шириной до 60 см. Листья зеленые, с тонким белым кантом по краю, слегка гофрированные.

Big Daddy (Большой папа)

Blue Angel (Голубой ангел)

Мощное растение крупных размеров с листьями выразительной фактуры. Это один из лучших сортов среди разновидностей с голубой листвой. Листья имеют диаметр до 30 см.

Белые цветки распускаются на метровых цветоносах.

Wolverine (Росомаха)

Wolverine (Росомаха)

Росомаха, раскидистые кусты которой растут в высоту до 35 см, а в ширину – до 80 см. Листья этого сорта узкие, ланцетовидные, сине-зеленые, с желтоватой окантовкой по краю.

Листва приобретает наибольший контраст на второй год роста.

Red October (Красный Октябрь)

Red October (Красный Октябрь)

Среднерослый гибридный сорт с эффектными черешками красного цвета, контрастирующими с зеленой листвой. Кусты вырастают до 40 см в высоту и 60 см в диаметре.

Цветки лилового оттенка распускаются в августе.

Broadway (Бродвей)

Broadway (Бродвей)

Красивый сорт с плотными рельефными сердцевидными листьями. Цвет листьев сизо-зеленый, по краю идет широкая неравномерная кайма желтовато-кремовой расцветки.

Кусты вырастают до 55-60 см в высоту. Цветки имеют лавандовый оттенок.

White Feather (Белое перо)

White Feather (Белое перо)

Один из наиболее эффектных гибридных сортов. Это красивое растение формирует компактный куст (до 35-50 см).

Изящные кремово-белые листья со светло-зелеными прожилками, действительно похожие на перья, сидят на зеленых черешках.

Сорт Paul’s Glory (Слава Пола)

Сорт Paul’s Glory (Слава Пола)

В 1999 года получил почетное звание «Хоста года», которое ежегодно присуждает Американская ассоциация производителей хост. Листья этого сорта очень декоративны. В их окраске чередуются желтые и сине-зеленые оттенки, будто нанесенные кистью художника.

При этом окраска может меняться на протяжении сезона. Начиная с трехлетнего возраста, листья приобретают интересную «жатую» фактуру. Кусты раскидистые: взрослое растение достигает 60-70 см в высоту и до 90 см в диаметре.

Praying Hands (Молящиеся руки)

Praying Hands (Молящиеся руки)

Оригинальный сорт с узкими листьями, которые растут практически вертикально. При первом взгляде на эту хосту сразу становится понятно, за что она получила свое необычное название.

Листья этого сорта имеют темно-зеленый цвет и волнистые края. Среднерослый куст в высоту достигает до 40 см.

Gold Standard (Золотой стандарт)

Gold Standard (Золотой стандарт)

Образует раскидистые куполовидные кусты до 60-70 см высотой и 120 см шириной.

Листья сердцевидной формы желто-зеленого или желтого цвета с контрастной темно-зеленой окантовкой по краю.

Gypsy Rose (Цыганская роза)

Gypsy Rose (Цыганская роза)

Привлекательное растение с выразительными листьями, имеющими четкие светлые и темно-зеленые цветовые зоны.

В высоту кусты этого эффектного сорта достигают 40 см, а в ширину – до 75 см.

Guacemole (Гуакамоле)

Guacemole (Гуакамоле)

Прекрасный вариант для тенистого сада. Блестящие сердцевидные листья этого сорта имеют оттенок зеленого яблока с темно-зеленой каймой по краю. В высоту кусты растут до 60 см и имеют диаметр 70-100 см.

В 2002 году этот сорт стал «Хостой года» по версии Американской ассоциации производителей хост.

Liberty (Свобода)

Liberty (Свобода)

Красивый сорт, который сохраняет свою декоративность в течение всего периода вегетации. Плотные листья эффектной контрастной расцветки являются одними из самых запоминающихся.

Поздней осенью, когда листва других сортов уже отмирает, Liberty будет продолжать радовать глаз в засыпающем саду. С возрастом кусты этого сорта быстро разрастаются и приобретают красивую форму, а кайма на листьях становится шире.

Moerheim

Moerheim

Высокорослый быстрорастущий сорт. Кусты достигают как в высоту, так и в ширину до 60 см.

Сердцевидные листья имеют длину 15-20 см, темно-зеленую окраску и белую тонкую кайму по краю листовой пластины.

Patriot (Патриот)

Patriot (Патриот)

Популярный сорт в декоративном садоводстве. Небольшие компактные кусты достигают 40 см в высоту и разрастаются в ширину до 70 см.

Темно-зеленые листья очерчены контрастной беловато-кремовой широкой каймой. Цветет этот сорт во второй половине лета лавандовыми цветками.

Сорт Purple Heart (Пурпурное сердце)

Сорт Purple Heart (Пурпурное сердце)

Относится к красночерешковым разновидностям. Селекционерами пока еще не выведены сорта с красными или пурпурными листьями, но первый шаг в этом направлении уже сделан.

Красно-коричневые черешки этого сорта контрастируют с ярко-зеленым оттенком листвы, а цветоносы имеют такой же насыщенный цвет. Бледно-лиловые цветки, которых насчитывается до 30 на каждом цветоносе, отливают пурпурным тоном у основания.

Risky Business

Risky Business

Сорт с плотными темно-зелеными листьями, по центру которых проходят четко очерченные кремово-белые полосы. Кусты вырастают до 40 см в высоту и до 60 см в ширину.

Цветет в июле лавандовыми цветками на длинных цветоносах.

Sharmon

Sharmon

Очень эффектный сорт, способный стать украшением любого тенистого сада. Кусты вырастают в высоту до 55 см, а в ширину – до 80 см.

В окраске листьев ярко-зеленый оттенок сочетается со светлой зеленью и желтовато-кремовыми участками и полосами, придавая растению необычный декоративный вид.

Stiletto (Стилет)

Stiletto (Стилет)

Оригинальный сорт с длинными узкими листьями и невысокими кустами, вырастающими до 25-35 см. Слегка волнистые листья имеют зеленый цвет и тонкую белую кайму по краю.

Цветет этот сорт небольшими цветками колокольчатой формы светло-сиреневого оттенка.

Undulata Mediovariegata

Undulata Mediovariegata

Компактный сорт, который относится к волнистым разновидностям хост. Красиво закрученные листья привлекают внимание волнистыми краями и контрастной кремово-зеленой расцветкой.

Кусты высотой до 40 см эффектно смотрятся на клумбах и в ландшафтных композициях.

Curly Fries

Curly Fries

Оригинальный низкорослый сорт. Листья с волнистыми краями очень узкие и длинные, нарастают быстро, образуя своеобразную «копну». Кусты достигают 25-30 см в высоту.

Светло-зеленые листья постепенно меняют свою окраску на желто-зеленую.

Читайте также: Выращивание кофейного дерева в домашних условиях, сорта, посадка и уход, размножение, возможные болезни: сам себе бариста (Фото & Видео) + Отзывы

Размножение

Размножается она несколькими способами:

Семена хосты

1 Семенами. Семена следует высевать весной в горшочки или в начале июня сразу в открытый грунт. При этом способе размножения сеянцы развиваются очень медленно и достигают декоративного вида только на четвертый год.

Размножение черенкованием

2 Черенкование. Этот способ применяют с мая по июнь. На черенки берут молодые побеги с «пяткой» и укореняют их в условиях повышенной влажности.

Деление корневища

3 Деление корневищ. Это основной способ размножения. Деление разросшихся кустов производят весной (апрель-май) или осенью (август-сентябрь). Не следует проводить деление слишком часто – это затормозит развитие кустов и снизит их декоративность.

Читайте также: Хризантема домашняя: описание, сорта, выращивание в горшках, уход и размножение, возможные болезни (40+ Фото & Видео) +Отзывы

Посадка

Высаживают хосту в открытый грунт ранней весной или осенью. Весной – до того как распустятся листья, осенью – после цветения, но с тем расчетом, чтобы растения успели укорениться до холодов и смогли хорошо перезимовать.

Посадка растения весной

Она может расти на одном месте свыше двух десятилетий, а ее кусты склонны разрастаться. Это нужно учитывать, высаживая растения в саду. Расстояние между кустами нужно делать от 30 до 60 см, в зависимости от вида и сорта растения. Если экземпляры относятся к гигантским разновидностям, расстояние между такими растениями необходимо увеличить до 80-100 см.

Яму для посадки следует подготовить достаточной ширины, поскольку корневая система хосты разрастается вширь. В яму нужно добавить перепревший навоз, торф, небольшое количество песка и все перемешать. Ростовые почки должны располагаться на уровне почвы. После посадки растение поливают и мульчируют.

Читайте также: Цветок Гвоздика – описание, виды и сорта, способы выращивания и размножения, посадка и уход (60+ Фото & Видео)

Условия выращивания

Хоста – растение теневыносливое и нетребовательное. Эти многолетники предпочитают тенистые места, могут переносить нерегулярные поливы, хорошо выдерживают морозы и не предъявляют больших требований к уходу. Однако существуют разновидности, способные расти на солнечных участках – к ним относятся, в основном, сорта с желтыми листьями.

Некоторые сорта хорошо растут на солнечных участках

Она нетребовательны к почвам, но лучше других им подходит рыхлый, богатый, слабокислый грунт, например, кислые суглинки. Почва должна быть умеренно увлажнена, но чрезмерной сырости не переносят. Растения являются морозостойкими, однако в холодных регионах на зиму рекомендуется проводить мульчирование или укрывать кусты утепляющими материалами.

Особенность растения состоит в близком расположении корней к поверхности почвы. Именно поэтому растения могут пострадать от морозов зимой. Вымерзание происходит, как правило, вследствие излишней влажности и вымокания. Этому больше других подвержены растения, достигшие шестилетнего возраста, и старше.

Поверхностное расположение корней может также привести к их перегреву в жаркие летние месяцы. По этой причине для растений лучше подобрать тенистый или полутенистый участок. Что касается южных регионов, то в этих областях хосту можно успешно выращивать исключительно в тени.

Читайте также: Рудбекия: посадка и уход за растением в открытом грунте. Сорта рудбекии для оформления приусадебного участка, полезные свойства (80+ Фото & Видео) +Отзывы

Уход в саду

Часто можно встретить такое выражение: хоста – растение для ленивых. Выращивание этих декоративных многолетников не представляет особой сложности, следует только обеспечить им комфортные условия для хорошего роста и развития.

Хоста – неприхотливое растение

Отзывчивы на внесение удобрений. Полив этим многолетникам требуется только в засушливые летние месяцы при отсутствии дождей. Нужно обязательно защищать растения от улиток и выпалывать сорняки.

Читайте также: Бересклет: Описание растения, виды и сорта, выращивание, посадка в открытом грунте и уход, размножение (65+ Фото & Видео) +Отзывы

Болезни и вредители

При грамотной агротехнике хосты достаточно устойчивы к заболеваниям. Из вредителей опасны гусеницы и слизняки, которые поедают листья и снижают декоративность кустов.

В этом случае действенным методом будет мульчирование прикорневой розетки опилками и золой. При нападении большого количества насекомых можно обработать кусты инсектицидом.

Листья, пораженные болезнью

Из заболеваний наиболее коварен вирус хосты Х или HVX (Hosta Virus X) – специфическое заболевание, открытое в 1996 году. Оно может продолжительное время протекать в скрытой форме, после чего растение начинает погибать: листья деформируются, покрываются пятнами и отмирают. В настоящее время ученым не удалось найти действенного средства от этого заболевания.

Единственное, что может сделать владелец садового участка – удалить и сжечь больной куст при обнаружении первых признаков болезни, пока вирус не распространился на здоровые соседние растения. Периодически следует проверять кусты, растущие в саду, и внимательно рассматривать новые экземпляры перед тем, как их приобрести.

Читайте также: Колеус: описание, виды и сорта, выращивание из семян, посадка и уход в домашних условиях и в открытом грунте (80+ Фото & Видео) +Отзывы

В ландшафтном дизайне

Растения высоко ценятся за свою теневыносливость и декоративность. Хосты нашли широкое применение в ландшафтном дизайне и приусадебном садоводстве. Крупные экземпляры великолепно смотрятся в одиночных посадках, миниатюрные хосты способны украсить альпийскую горку или рабатку, растения среднего размера колоритно выглядят в ландшафтных композициях.

Украшение клумбы

Хосты прекрасно подходят для клумб и бордюров. На фоне дорожек, ухоженных газонов и почвопокровных «ковриков» их пышные кусты могут в полной мере продемонстрировать свою декоративность.

Хосты живописно сочетаются с низкорослыми хвойными многолетниками, астильбами, люпинами, лилейниками, папоротниками, морозниками и другими цветущими и декоративно-лиственными растениями.

5.5 Total Score

Для нас очень важна обратная связь с нашими читателями. Оставьте свой рейтинг в комментариях с аргументацией Вашего выбора. Ваше мнение будет полезно другим пользователям.

Простота ухода

7.5

Оригинальность

9

Оценки покупателей: 1.5 (2 голосов)

82 фото очень многогранного и очень красивого растения

Хоста – настоящее украшение любой клумбы. Растение многолетнее из семейства лилейных. Хоста растет практически на любом участке, она не прихотлива в уходе, с каждым годом становится все больше, а самое главное, что хоста не боится вредителей.

Насекомые не едят растение за его горький сок, несмотря на то, что растет хоста в тени, плесень и грибок обходят его стороной. Отличается растение красивыми резными листьями разноцветной окраски зеленых и белых оттенков.

Растет хоста преимущественно в ширину, листья способны покрыть даже целый цветник, в результате образуется густая зеленая шапка.

Максимальная длина в ширину достигает полутора метров. Цветет хоста маленькими белыми цветками, которые вырастают сверху стебля. Сами цветки бледно-фиолетового цвета, маленького размера.

Хоста ценится не за свое цветение, главное украшение любого участка – это шикарные зеленые, плотные листья.

Существует много разновидностей хосты, отличается она только цветом и формой листьев.

Хоста совсем не прихотлива в уходе, может рати несколько лет подряд без обрезания и подкормки. Хоста может расти до 20 лет.

Красиво хоста смотрится вечером или раним утром, когда капельки росы покрывают зеленые листья, от этого достигается еще больший объем листьев. Растение наполняется свежестью, сочностью, покрывается влажной пыльцой.

Хосту чаще всего сажают вместе с туей, хвойными декоративными растениями. Пропалывать землю вокруг цветка не обязательно, куст имеет широкие листья, под ними все время темно, сорняки практически не прорастают.

Хоста хорошо переносит зиму, однако садоводы рекомендуют ее все же укрывать опилками или мхом. Растение способно рано просыпаться после заморозков, еще вначале мая, когда морозы продолжаются, растение раскрывается, зеленеет, развивается. В это время необходимо его укрыть.

Содержимое статьи:

Как выбрать рассаду?

Хоста высаживается в цветник рассадой, которую можно вырастить самостоятельно, а можно купить готовые молодые кустики.

Если корневая система открыта: в таком случае самих корней как – бы еще нет, имеется лишь почка, которую укореняют в землю. Зацвести такая хоста сможет не раньше чем три года. Рассаду сажают в землю, в небольшую луночку, присыпают землей.

Если корневая система закрыта: в таком виде растение посадить намного легче, оно быстрее приживется в отличие от предыдущего способа. Рассада закапывается в лунку, присыпается после землей, при этом землю нужно слегка примять. После этого земля увлажняется.

Хосту лучше покупать в проверенных местах или крупных цветочных магазинах, желательно, чтобы корневая система была закрыта с небольшими листочками. Таким образом, осенью у вас будет молодое растение, вполне готовое к полноценному развитию и цветению.

Перед тем как сажать цветок, необходимо также проверить целостность корня, они должны быть плотными, твердыми, белого цвета.

Если корешки незначительно повреждены, их следует отрезать, однако такие корни брать не стоит, если есть выбор, то лучше покупать здоровую завязь.

Хоста, посадка и уход?

Посадка хосты в грунт – дело не хлопотное, она должна расти в теневом месте, защищенном от ветра. На солнце растение сгорает, листья становятся коричневыми и заворачиваются. Каждый сорт требует определенного места, некоторые сорта цветка любят свет.

Сажается хоста в апреле, если посадить ее осенью, можно не успеть до заморозков, корни могут не развиться и растение погибнет от морозов зимой.

Главное требование для почвы – это ее легкость, рыхлость, она не должна быть плотной, тяжелой, к корням должен хорошо поступать воздух и не застаиваться вода. В почву можно внести торф или песок, если земля плотная.

Чтобы не допустить застоя воды, к корням добавляют керамзит, он служит в качестве дренажа, для выведения влаги. После посадки хосту поливают.

Теперь стало известно, как выбрать растение хоста, посадка и уход в открытом грунте как описано выше, также занятие довольно не сложное.

Виды хосты

Существует довольно много разновидностей цветка. Обратите внимание на фото хосты, в зависимости от сорта, растение отличается между собой.

Курчавая – отличается ярко-зелеными листьями с белой каймой по краям. Листья растут вверх, образуя пышный куст.

Белоокаймленная — сорт хосты схож с сортом курчавой хосты, только растет она в ширину.

Зибольда – уникальный сорт хосты, когда листья с шероховатой поверхностью, мягкие, широкие, темно – зеленые.

Подорожниковая – такая хоста встречается на дачных участках, заброшенных дорогах. Многие ее путают с подорожником из — за схожего вида.

Волнистая – очень красивый вид. Листья такого растения белые с зеленой каймой по краям. За счет преобладания белого цвета на листьях хоста кажется объемной.

Чем может болеть хоста?

Хотя данное растение и устойчиво к различным вредителям и заболеваниям, его могут поражать, серая гниль, улитки, слизни, нематоды. В случае одного из заболеваний растение опрыскивают специальным составом.

Абсолютно всем нравится цветок хоста, фото-картинки показывают красоту ее цветения.

Фото растения Хоста



что это такое? Оформление участка цветами. Какую почву любят уличные растения в саду? Хоста ланцетолистная и другие самые красивые виды

Многие садоводы при оформлении своего участка склоняются именно к выбору хосты в качестве многолетнего растения. Этот кустарник непривередлив в уходе, устойчив к сильным холодам и обладает уникальным цветом листвы. В этой статье вы ознакомитесь с описанием видов и сортов хосты, а также с секретами выращивания и размножения этого растения.

Что это такое?

Хоста относится к многолетним растениям семейства Спаржевые. Изначально этот многолетник носил имя «Функия», в честь немецкого ботаника Г. К. Функа, однако в начале XX века растению дали современное название – уже в честь австрийского ботаника Николауса Томаса Хоста. Родина кустарника – территории Дальнего Востока.

Период цветения хосты, в зависимости от сорта и вида, приходится на июнь-август.

Соцветия этого растения расположены на достаточно высоких цветоносах, обладают воронковидной или колокольчатой формой и могут встречаться в белых, лиловых и сиреневых оттенках.

Главным преимуществом хосты как садового растения являются ее роскошные листья, формирующие прикорневую розетку. В зависимости от сорта они могут быть узкими, округлыми, тонкими или плотными, а также отличаются индивидуальным оттенком – от пестрых и светлых цветов, до глубоких изумрудных тонов.

Среди всех остальных садовых растений хоста считается настоящим долгожителем – некоторые сорта этого растения при благоприятных условиях и тщательном уходе способны дожить до 25 лет.

Обзор видов и сортов

На сегодняшний день существует около 4 отдельных классификацией хост: по величине, по типу окраса, а также классификации разновидностей и сортов этих садовых растений.

Классификация в зависимости от цвета стеблей и листьев.

  • Голубая. Растения такого типа обладают листвой голубых оттенков.
  • Желтая. Включает в себя все сорта хосты с градиентными желтыми листьями.
  • Зеленая. Эти растения обладают светло-зелеными или изумрудными листками.
  • Вариегата. К этому типу относятся все сорта хост с неординарной и пестрой окраской, а также растения с характерным светлым или пятнистым обрамлением листьев.
  • Медиовариегата. Хосты такого типа обладают светлыми листами с зеленой каймой по контуру листа.

Классификация в зависимости от размеров хосты.

  • Карликовые разновидности хосты называются Dwarf. Эти растения не вырастают выше 10 см.
  • Миниатюрные – Miniature. Высота чуть больше – от 10 до 15 см.
  • Хосты маленького типа – Small. Высота от 15 до 25 см.
  • Medium – здесь располагаются растения со средней высотой от 0,3 до 0,5 м. Это самая распространенная группа с огромным количеством сортов.
  • Large – эти растения способны вырастать до 0,7 м.
  • К хостам типа Giant относятся все сорта таких растений высотой от 70 см и более.

Все садовые хосты подразделяются на несколько разновидностей, каждая из которых обладает индивидуальными внешними качествами и предпочтениями в посадке.

  • Курчавая (или кудрявая). К растениям этой разновидности относятся низкорослые миниатюрные хосты с листьями сердцевидной формы, острыми краями и закругленными кончиками. У таких красавиц также присутствует характерная белая кайма вдоль краев листа. Несмотря на относительно небольшую высоту, каждый листик такой хосты может вырастать до 16 см в длину.
  • Волнистая. Это более высокое растение, цветонос которого может вырастать до высоты в 80 см и более. Такое название эта хоста получила благодаря уникальной волнистой форме своих листьев, каждый из которых может вырасти до 20 см в длину. Цветы у таких растений напоминают колокольчики и отличаются мягким лиловым цветом.
  • Подорожниковая. Довольно высокое растение, стебли которого способны достигать 70 см в высоту. Округлые и тонкие листья этой хосты обладают ярким зеленым оттенком, а также наделены характерным глянцевым блеском, который особенно заметен на солнце. Период цветения приходится на август – соцветия блеклые, серые и не выделяют растение на фоне цветника.
  • Вздутая. Эти уличные растения обладают большими и практически круглыми темно-зелеными листьями до 25 см в длину каждый. Соцветия расположены на длинном цветоносе, цветки маленькие и отливают мягким сиреневым оттенком. Могут вырастать вплоть до 0,8 метра.
  • Высокая. Такие хосты обладают плотными листьями насыщенного зеленого цвета. Каждый лист крепится к стеблю растения с помощью длинных и плотных черешков. Обладает низкими цветоносами. Цветки в соцветии расположены плотно, по форме трубчатые, отличаются лиловым окрасом.
  • Ланцетолистная. Эту разновидность еще называют узколистной. Средняя высота этих многолетних растений – около 35-40 см. Отличительной особенностью хосты являются заостренные глянцевые листья темно-зелёного окраса.
  • Королевская. Эти гиганты (до 80 см в высоту) отличаются длинными ярко-зелеными листьями, а также большими белыми цветами (типа колокольчик), которые источают очаровательный и легкий аромат. Последние бутоны это растение сбрасывает только под заморозки.
  • Хоста Зибольда. Эта разновидность хосты обладает практически круглыми плотными листьями насыщенного зеленого цвета, которые способны достигать 35 см в длину. Характерная особенность вида – восковое покрытие листьев, которое делает их матовыми и гладкими. Цветение приходится на июль, сами цветоносы обладают пастельными фиолетовыми оттенками.
  • Хоста Форчуна. Напоминает разновидность Зибольда, однако обладает куда меньшей длиной листьев и более высокими цветоносами, цветение которых приходится на август.

Если рассматривать самые популярные сорта растения, то среди пестролистных хост можно выделить «Фёрст Мэйт», «Патриот», «Вайд Брим», «Унивитата» и «Ауреомакулата».

Самыми красивыми и солидными сортами хосты считаются растения с плотными листьями изумрудного, темно-зеленого и нефритового цвета. Здесь можно выделить такие сорта, как «Джун», «Элеганс» и «Блю Кадет».

Выбираем место

Один из главных факторов при желании посадки хосты на дачном участке – подбор подходящего места. Здесь стоит обратить внимание на ряд факторов.

  • Тень. Несмотря на то, что некоторые садоводы называют хосту «теневой королевой», это растение не любит расти в полной тени. Это должен быть частично освещенный солнцем участок, где естественный свет будет попадать на растение до 12 часов дня и после 6-7 часов вечера. При выборе интенсивности освещения ориентируйтесь на сорт вашей хосты. Для пестрых сортов нужны солнечные места, для более темных и холодных окрасов – места с большей тенью.
  • Влажность. Все сорта и разновидности хосты с плотными листьями насыщенных оттенков просто обожают обильный полив, однако не терпят застоя влаги. Именно поэтому такие растения не стоит высаживать на низких участках, где постоянно будет скапливаться влага.
  • Питательность и кислотность почвы. Хосты очень привередливо относятся к типу грунта, на котором их высаживают. Они больше всего любят влажную, суглинистую, слабощелочную или слабокислую почву с большим количеством питательных элементов.
  • Вентиляция. Поскольку хоста относится скорее к низкорослым растениям благодаря своему небольшому росту, сильный ветер ей не повредит, а вот застои воздуха или плохая вентиляция могут негативно сказаться на состоянии листьев или соцветий.
  • С чем сочетается. В случае хосты очень важным фактором при выборе места на клумбе является ее совместимость с другими растениями. Для полутенистого участка лучше всего подойдут комбинации хосты с барвинком, гейхерой, горлянкой, примулой или папоротниками. Очень эффектно хоста будет смотреться совместно с цветком астильба.

Правила посадки

Единственное серьезное отличие посадки хосты от высадки других многолетних растений в открытый грунт – наличие широких посадочных лунок. Дело в том, что корневая система хосты очень быстро разрастается и нуждается в большом пространстве для развития.

Высаживать хосту в саду следует в середине весны (вторая половина апреля или первые числа мая) после наступления теплых деньков, но до периода сокодвижения и активного роста корневой системы.

Либо же в самом начале теплой осени (последние числа августа и начало сентября).

Еще один важный момент при высадке хосты на клумбе – определение расстояния от этого растения до соседних садовых культур. Так, для карликовых и средних сортов следует выдерживать расстояние до 30 см. В случае больших и гигантских видов выбирайте расстояние не менее чем в 40 см до близлежащих растений.

Сам процесс высадки хосты на участке выглядит довольно просто.

  • На участке с помощью лопаты или агротехники выкапываются широкие ямы 1,2-1,4 метра. Минимальная глубина – 30 см.
  • За час до высадки растений земля в ямах обильно поливается, затем организуется дренажный слой из щебня или битого кирпича
  • Часть подготовленного грунта помещается в яму, формируется небольшая горка, на которую устанавливается саженец.
  • Корни растения равномерно распределяются в яме. Они должны расти в разных направлениях и ни в коем случае не загибаться.
  • Остальной грунт равномерно распределяется между корнями растения в лунке. Корневая шейка растения должна слегка приподниматься над уровнем земли – со временем почва слегка осядет и место высадки выровняется.
  • После этого земля утрамбовывается и еще раз поливается. После высыхания земли проводится мульчирование.

Особенности ухода

Уход за хостой не вызовет сильных затруднений даже у начинающих садоводов. Советы по основным этапам ухода за этим растением будут рассмотрены ниже.

Полив

Главная задача садовода в случае хосты – часто поливать растение и не допускать полного пересыхания земли в приствольном круге. Чтобы влага на более долгий срок сохранялась у корней растения, следует организовать слой мульчи из торфа, коры, соломы или хвои. Кроме того, сама земля должна обладать достаточной водопроводимостью.

Полив хосты проводится не реже 2-3 раз в месяц в осенние и весенние сезоны, и около 1 раза в 3 дня летом или после высадки молодых саженцев на новое место. В зависимости от возраста растения на один полив должно уходить от 1 до 3 десятилитровых ведер отстоявшейся воды. Перед поливом земля в приствольном круге разрыхляется. Полив хосты желательно проводить ранним утром – до 10-11 часов.

Самая главная ошибка садоводов при поливе хосты – поверхностный полив именно листьев такого растения. При таком поливе капли влаги скатываются по гладким листьям за пределы корней растения, что приводит к деградации корневой системы или гниению розеток листьев.

Обрезка

Насчет обрезки этих растений мнения садоводов разнятся. Некоторые доказывают, что перед наступлением холодов следует срезать почти вровень с землей всю верхнюю часть – как цветоносы, так и листья. По мнению экспертов, это не допускает заражения корневой системы хосты грибковыми заболеваниями и не провоцирует появление вредителей.

Другие садоводы убеждены, что на зиму обрезать стоит лишь цветоносы, а сами листья оставлять нетронутыми. Пожухлая листва надежно укроет корневище от зимних морозов.

Профилактическую обрезку соцветий и сухих листьев хосты можно проводить в любое время. Эта процедура также включает осмотр растения на наличие гнилых корневищ или вредителей.

Пересадка

Пересадка является естественным и даже желательным процессом, если речь идет о таком садовом растении, как хоста. Обычно она проводится осенью совместно с процедурой деления куста. Во время этой процедуры материнский куст выкапывается, корневая система очищается и разделяется острым ножом на отдельные побеги с двумя розетками и мощными корнями. Высадку новых кустов следует проводить не позднее середины сентября, чтобы они успели прижиться до наступления холодов. Процесс высадки таких кустиков ничем не отличается от посадки молодого куста хосты.

Если место высадки выбрано удачно и все условия соблюдены, это растение может успешно расти на одном месте на протяжении 15-20 лет и без пересадки.

Зимовка

Подготовка хосты к зимовке предполагает полное срезание цветоносов, а также листьев растения. Кроме того, вся опавшая листва в приствольном круге убирается, а земля разрыхляется. С помощью такой процедуры вы уничтожите личинки вредителей, помещенные в землю на период зимовки. Чтобы сберечь корневую систему растения и укрепить иммунитет хосты перед зимой, следует организовать в приствольном круге питательный слой мульчи из торфа или не свежего навоза.

В дополнительном укрытии на зиму хоста не нуждается. Это достаточно морозостойкое растение, которое способно переносить даже самые лютые холода.

Подкормка

Для декоративных разновидностей хосты подкормка является обязательным элементом ухода – она влияет на яркость окраса листвы растения, на плотность листьев и мощность корневой системы. Хоста отлично относится как к органическим, так и минеральным удобрениям.

Органика поставляется растению в виде слоя мульчи из хвои, компоста, сена, соломы, торфа, разложившегося навоза или хвои. Это не только удобряет верхнюю корневую поросль, но и удерживает влагу у поверхности земли. Мульчирование проводят 2 раза в год – до активного роста корней и летом – до образования соцветий.

Минеральные удобрения могут вноситься напрямую в приствольный круг возле куста хосты (в виде раствора или гранул) либо смешиваются с органическими удобрениями в слое мульчи. Такие подкормки проводятся до 3-4 раз за сезон – в зависимости от возраста и сорта хосты.

Способы размножения

Садоводы прибегают всего к 3 способам размножения хосты: черенкование, выращивание рассады из семян, а также деление куста.

Самым распространенным считается размножение путем деления куста, которое обычно проводится совместно с осенней пересадкой материнского растения. Для этой процедуры выбираются уже взрослые кусты (4-5 лет) с развитой и мощной корневой системой.

Сам процесс такого размножения уже был описан в подзаголовке «Пересадка».

Размножение с помощью черенков – второй по популярности метод. В данном случае от материнского растения отделяется крепкий и взрослый побег с собственной корневой системой. После этого черенок высаживают в отдельное место и укрывают на несколько дней бутылкой или пластмассовой банкой.

Развести хосту можно и семенами, но такое размножение – достаточно сложный и не особенно популярный метод. Вам сразу стоит приготовиться к низкому проценту всходов и большому количеству потраченного времени.

До посадки в контейнеры семена хосты следует выдержать в растворе стимулятора роста. Лучшее время для посадки семян – середина апреля или начало мая. После высадки семян контейнеры укрываются прозрачной пленкой для создания естественного микроклимата. Изредка пленку следует приоткрывать для полива и проветривания семян. Примерно через 3 недели вы заметите первые всходы. Пикировка проводится после появления у рассады 2-3 листиков.

Болезни и вредители

Хоста обладает невероятно крепким здоровьем, что совместно с грамотным уходом снижает вероятность возникновения заболеваний или появления вредителей к минимуму.

Если говорить именно о заболеваниях, то чаще всего хосту поражает так называемая серая гниль, склеротиния, а также филлостиктоз.

  • Заражение серой гнилью происходит при частом застаивании воды в розетках растения, а также у корневой поросли. Растение, пораженное этим заболеванием, начинает активно желтеть и скидывать листву.
  • Филлостикоз является опасным грибковым заболеванием, которое выражается в появлении локальных бурых пятен на листьях хосты. Обычно эта болезнь появляется на растениях, которые болезненно пережили зиму.
  • Склеротиния поражает листья и соцветия хосты и выражается в виде характерной белой плесени или паутины.

Для борьбы с этими заболеваниями используются стандартные фунгициды на основе фольпета. Со склеротинией лучше всего справятся дихлораны. В редких случаях растения советуется выкапывать и полностью уничтожать, чтобы не спровоцировать заражение соседних цветов.

Хоста также подвержена атакам ряда определенных вредителей. Самым опасным вредителем являются слизни, однако вред растению могут также принести гусеницы насекомых, жуки или даже кузнечики (уничтожаются инсектицидами).

Определить присутствие луговых слизней и улиток можно по характерным дырам на листьях растения. В борьбе с этими вредителями должны помочь специальные приманки для слизней.

Обычно в роли приманки садоводы используют пиво, на запах которого и сползаются слизняки.

Еще один опасный вредитель – стеблевые нематоды. Самым явным признаком их присутствия являются темные пятнышки вдоль жилок на листве хосты. К сожалению, от яиц этих паразитов избавиться невозможно – куст полностью выкапывается, а территория вокруг его места высадки дезинфицируется.

Возможные проблемы

Некоторые садоводы сталкиваются с проблемами при выращивании хосты на даче. Самые частые проблемные ситуации: цветок плохо растет, не цветет, сохнет. Чаще всего эти проблемы появляются из-за целого ряда факторов.

  • Основными причинам медленного роста может быть нерегулярная подкормка или слишком близкое соседство к деревьям и другим кустарникам, забирающим влагу.
  • Если хоста не цветет – следует узнать ее сорт и определить, не относится ли ваше растение к поздним сортам (да и не забывайте, что хоста ценится именно за листву, а не соцветия).
  • Причиной высыхания листьев хосты может быть все что угодно – от слишком скудного полива и избыточного освещения, до банального заражения растения вредителями.

Советы для начинающих

Чтобы процесс выращивания хосты в открытом грунте был максимально легким и продуктивным, прислушайтесь к следующим советам.

  • Точно определите сорт вашей хосты. Это будет напрямую влиять на особенности ее размножения, время высадки, интенсивность полива, требования к типу почвы и освещению.
  • Несмотря на морозостойкость этого растения, первые 2-3 зимовки молодые кустики хосты будет нелишним укрыть лапником. Особенно это актуально для регионов с сильными морозами, но тонким слоем снега зимой.
  • Начинающим садоводам не следует размножать хосту делением куста. Это сложный и стрессовый для растения метод, который не терпит ошибок. Начинайте размножение именно с черенкования.

Использование в ландшафтном дизайне

Сегодня крупные и карликовые разновидности хосты активно используются в оформлении дачных участков. Они могут быть как полноценной частью цветника или клумбы, так и обрамлять садовые дорожки или формировать бордюры.

Однозначным плюсом хосты является приспособленность к росту в затемненных участках. Это одно из немногих растений, которое будет удачно смотреться вокруг дерева (например, под яблоней).

Хоста способна создать утонченную композицию совместно с садовыми растениями непрерывного цветения. Рядом с этим многолетником могут отлично смотреться практически все садовые культуры, однако лучше всего хоста гармонирует с гейхерами, пионами, можжевельником, астильбой, гортензиями и папоротниками.

Популярная на сегодняшний день альпийская горка приятно освежится кустом пестрого кустарника хосты. Нередко это растение используется для создания такого модного на сегодняшний день декоративного объекта, как миксбордер.

Советы по выращиванию хосты в видео.

Виды и сорта хост — описание разновидностей цветков с фото

Характеристика, как правильно выбрать место для саженцев, сколько видов, как выращивать, название сортов хоста с фото и подробное описание их отличительных свойств читайте далее в этой статье.

Содержание статьи

  1. Ботаническое описание растения
  2. Виды и сорта хосты
  3. Самые популярные сорта
  4. Посадка
  5. Уход
  6. Подготовка к зиме
  7. Вредители и болезни

Ботаническое описание растения

Функия, или иначе Хоста это одно из самых популярных среди садоводов растение. А популярным его сделал необычный внешний вид  (можно выбирать не только по соцветиям, но и по узорам) и уникальное долгожительство –  не теряет своих сортовых качеств и может произрастать на одном месте более 20 лет!

Ранее Хосту относили к семейству Лилейные, по новой же классификации она относится к семейству Спаржевые. Родиной этой экзотики считается Япония, откуда она была завезена в Европу, а из Европы распространилось на Дальний Восток, в Россию и Азию. На сегодняшний день этот цветок широко распространился по планете – некоторые его виды можно встретить в Китае и даже в Кореи.

Внешне это многолетнее травянистое с множеством побегов у корневища. Разные сорта отличаются значительным разнообразием формы зелени и её расцветок. В период цветения из куста вырастают высокие до одного метра побеги, на конце которых распускаются бутоны в форме колокольчика, или воронки. Многие сорта обладают приятным устойчивым ароматом.

Виды и сорта хосты

Сорта хоста и виды хоста. За те столетия, что Функия известна ботаникам (её открытие принадлежит немецкому ботанику Генриху Функа (1771-1839), в честь которого она и было первый раз названо) усилиями селекционеров было выведено множество самых невероятных сортов, что значительно усложнило классификацию. 

Американцы предлагают такой краткий каталог разделение на группы, используемый для ландшафтного проектирования:

  • Гигантские – рост превышает 70 см.
  • Большие  – до 70 см.

Самая обширная и разнообразная группа средней величины – до 50 см. Чаще всего представители именно этой группы украшают собой цветники и дачные участки.

  • Небольшие  – не более 25 см.
  • Миниатюрные  – ростом всего в 15см.
  • Карликовые – не выше 10 см.

Данная классификация далека от идеальной, но даёт примерное представление о разнообразии форм этого рода. 

Хоста Зибольда

Этот экзотический декоративный сорт родом с японского острова Хонсю, был открыт ботаником Филиппе Зибольдом в конце 18 века, в честь него и получил своё название. Выглядит Зибольда, как большой кустарник с широкими ребристыми на ощупь, мясистыми листьями с небольшим сизым налетом. 

Несмотря на внушительные размеры самого куста, цветоносы вырастаю невысокими, около 40см в высоту. Они почти «голые» и цветут бледно-сиреневыми бутонами по форме напоминающими воронку. Корень стержневой, почти без ответвлений, может уходить в землю на метр и более.

Фото: хоста Зибольда

Элеганс

Декоративный элеганс с внушительными голубоватыми листьями, вырастающими до 18 см, которые собираются в восхитительный куст высотой почти до 90см. Элеганс украшает собой сад весь сезон независимо от периода расцвета, тогда, как многие растения теряют после него свою привлекательность. 

Цвeтёт Элеганс с июля по август шикарными бутонами лавандового оттенка. К исключительным внешним достоинствам стоит прибавить:

  • Устойчивость к морозам;
  • Теневыносливость;
  • Произрастание почти в любом типе почвы;
  • Устойчивость к заболеваниям и вредителям.

Фото: хоста Элеганс

Пауэль с Глори

Думаете чем украсить свою альпийскую горку, или декоративный садовый водоем? Пауэль с Глори буквально создан для этого! Так же он отлично подходит для выращивания в горшках и вазонах. Посадите Пауэль один раз и наслаждайтесь его великолепием целых 25 лет!

Отличительная особенность в зелени желто-зеленого оттенка, которая меняю свой окрас к концу сезона сначала до золотисто-желтого, а после до белого с зелено-голубой окантовкой. Лавандовые соцветия только добавляет красок в его и так богатую палитру.

Устойчив к засухам и холодам, предпочитает хорошо дренированную почву с низкой кислотностью. Благодаря плотной структуре тканей почти не боится повреждения слизнями.

Фото: хоста Пауэль с Глори

Френсис Вильямс

В отдельный сорт Френсис выделили относительно недавно, в 1970 году и назвали так в честь мисс Ф. Вильям, которая первая заметила его необычные голубоватые листья с желтой каймой среди кустов Зибольда Ауреомаргината. А поскольку Ауреомаргината относится к старинным японским гибридам, то же можно сказать и о Френсис Вильямс.

ФВ морозоустойчивый и хорошо себя чувствует в грунте любого типа. Выбирая место для его посадки, стоит позаботиться о ветрозащите.

Цветение Френсис приходится на середину летнего сезона – невысокие стебли оканчиваются  цветкам белого цвета, около 5 см в диаметре и собираются в кисти по 8 штук. 

Фото: хоста Френсис Вильямс

Ланцетолистная или узколистная хоста

Незаменимое украшение бордюра и последняя скрипка в летней цветочной композиции вашего сада. Когда все и вся уже отцвели, узколистная только начинает. Обычно это период с середины августа и аж до середины октября, если, раньше не начнутся снег и морозы, конечно.

Ланцетолистная вырастает в пышный куст, средних размеров: диаметром около полу метра и высотой около 40см. Поросль блестящая, зеленая, шириной около 8 см и длинной около 17см. В период цветения из куста вырастают невысокие стебли с бледно лиловыми колокольчиками.

Фото: хоста ланцетолистная

Волнистая

Как и многие ее сородичи, Волнистую завезли в Россию из солнечной Японии. В отличии от прочих уже описанных представителей рода, она не большая, ростом всего около 30см. Почву любит плодородную, богатую минералами.

Основное отличительное свойство это яркие белые полосы посередине небольших зеленых пластин размером около 20см. Эти необычные листья считаются особым шиком, из-за чего Волнистая часто применяется в ландшафтном дизайне. Цветёт фиолетовыми и белоснежными соцветиями, похожими на лилию.

Фото: хоста волнистая

Albomarginata

Еще один теневыносливый, устойчивый к холодам декоративник. Кусты вырастают до 50см и представляют из себя пышное скопление большой темно-зеленой поросли с белою каймой. Цветоносы вырастают относительно высокими, до 35 см и оканчиваются сиреневыми и фиолетовыми цветами около 6см в длину. Цветут Албомаргинаты с июля по август. Рекомендуется мульчирование на зимний период.

Variegata

Родом из Китая, на некоторых ресурсах так и называется – китайская волнистая Variegata. Варигата довольно большая – ростом до 60см. Растет быстро, вырастает пышной. Любит солнечные участки, но чувствует себя нормаль и в частично затемнённых местах (когда тень держится некоторую часть дня).

Пластины зеленые с белыми прожилками, немного похожи на зелень простой Волнистой Хосты, с которой состоит в близком родстве. Обычно цветение начинается в июле и заканчивается ближе к концу августа. Соцветия бледно-фиолетовые в форме колокольчиков.

Подорожниковая

Самый первый цветок в роду, который попал из Японии в Европу. В России его называют «лилия – подорожник» за сходство листьев с подорожником. В остальном и похож на большой куст подорожника, из которого в период цветения вырастают несколько голых стеблей. На них гроздями весят белые соцветия в форме колокольчиков и источают сильный приятный аромат. Вырастают стебли до 45см в высоту, а колокольчики достигают в длину 13см, что делает их довольно крупными на фоне всей лилии. 

Разрастается лилия-подорожник долго, на протяжении нескольких сезонов. Зато хорошо чувствует себя, как на солнце, так и в тени. Цветет она в июле и августе, от чего получила еще одно название – «августовская лилия».

Фото: хоста подорожниковая

Вздутая

По своему, уникальный сорт — единственный тераплойд  среди всего рода. Это значит, что для образования полноценных семян оплодотворение не нужно. Благодаря этому семена 100% сохраняют все сортовые наследственные признаки и не требуют контролируемой селекции.

Родиной цветка считается Корея, Китай и Япония. Внешне, это небольшой куст с частой тёмно-зеленой порослью, покрытой глубокими контурными прожилками по дуге от сердцевины к краю. Сама поросль имеют форму, схожу с любовным символом сердечка или вытянутым с боков куриным яйцом. Корень у куста не глубокий. Цветоносные стебли вырастаю до одного метра, и обильно цветут сиреневыми соцветиями с середины июля до конца августа. К сентябрю семена уже вызревают полностью.

Фото: хоста вздутая

Джун

Интересное решение для ландшафтного дизайна – оформления бордюров и клумб. Джун хорошо переносит прямые лучи солнца, но и в тени чувствует себя прекрасно. Более того, зелень меняет свой оттенок в зависимости от освещенности и времени года, что добавляет своего очарования. Весной середина у пластины светло-зеленая, а в разгар летнего сезона становится золотистой. Так же у них имеется голубая кайма, форма яйцеобразная. Изредка в кусте может вырастать голубоватая однотонная зелень – её рекомендуется удалять, для сохранения эстетичной картинки.

Хорошо смотрится соло, как самостоятельная часть ландшафтного дизайна. Джун устойчив к болезням и вредителям.

Гибридная

Это множество сортов с рядом общих характеристик: больший размер куста, укрупнённая зелень, различные её расцветки. Обычно это самые красивые хосты. Расцветка бывает:

  • Сизой;
  • Золотистой;
  • Голубой;
  • Желтой;
  • Белой;
  • В полоску
  • И с каймой.

Так же можно встретить двух- и даже трехцветные варианты.

Фото: хоста гибридная

Вайд Брим

Вайд Брим это гибрид, селекционированный британской фирмой Aden в далеком 1979 году. Считается декоративным с зеленью куполовидной формы. В совокупности всё растение достигает в высоту до 50см и цветет бутонами лавандовогооттенка с тонким приятным ароматом. 

Влаголюбивость у Вайд Брима повышенная, и от её нехватки цветение становится менее интенсивным и длительным. В период расцвета рекомендуется еще более обильный полив. Это создаёт некоторые сложности при поливе: почва должна быть с хорошими дренажными свойствами, чтобы при частом и интенсивном поливе вода не застаивалась, но и быстро грунт не пересыхал.

Хорошим индикатором недостатка влаги является характерная особенность Вайд Брима – зелень от нехватки воды становится заметно темнее на своих кончиках, чем обычно.

Фото: хоста вайд брим

Белоокаймленная

Особенность белоокаймленной в белом окаймлении пластины, длинной до 15 см, вытянутой продолговатой формы. К почве особо нетребовательна, но сырые болотистые участки категорически ей не подходят. Так же она любит полутень и быстро выгорает на солнце. Зелень формирует аккуратные кустики высотой около 25см и начинает своё цветение в июле. И вплоть до конца августа радует своими фиолетово-сиреневыми соцветиями кистевидной формы и длиною до 6 см.

Фото: хоста белоокаймленная

Форчуна

Многолетник из Японии, Форчуна была названа в честь биолога Р. Форчуна. Растение компактное с сердцевидной листов имеющей легкий восковой налет, что в сочетании с их тенелюбивостью предаёт Форчуне некоторую кукольность – в тени неопытному глазу может показаться, что Форчуна искусственная. 

Листовая пластина вырастает до 9см в ширину и 13см в длину. Цветоносы вытягиваются до полуметра и расцветают в начале августа воронковидными фиолетовыми соцветиями длиною в 6см. Почву Форчуна предпочитает кислую, допускать ее пересыхание крайне не желательно, из-за чего отлично подходит для оформления водоемов.

Фото: хоста форчуна

Золотой стандарт

Очень популярный среди цветоводов «Золотой стандарт» был так назван благодаря золотистой окраске листовых пластин, что делает его украшением цветника вне зависимости от цветения. А благодаря своей пышности от незаменим при украшении деревьев и кустарников, в группе с другими растениями на клумбах и в больших горшках, украшающих беседки и здания.

Средняя высота 60-70см, участки предпочитает тенистые. Грунт требуется питательный, с хорошими дренажными свойствами. Приятным дополнением ко всем его положительным свойством является исключительная зимостойкость. Цветет с июля по август сиреневыми соцветиями вытянутой формы.

Фото: золотой стандарт

Aureomarginata

В ландшафтном дизайне Ауреомаргината используется в основном для озеленения участка в затемнённых областях сада, для украшения фундаментов и дорожек. Как и большинство представителей рода, она устойчива к холодам, хорошо переносит тень и неприхотлива в отношении почвы.

Высотою кусты достигают 50см, в диаметре 120см. Зелень крупная, фактурная с узорами и желтой каймой. Цветение начинается в июле и длится до кона августа. Для зимовки рекомендуемо мульчирование торфом или сухим перегноем.

Самые популярные сорта

Ниже следуют самые популярные среди садоводов сорта: тандербол, фест фрост, сам энд сабстенс, капитан эдвенчур, ти рекс и со свит. Каждый из них обладает своими уникальными особенностями и станет заметным украшением любого сада.

Thunderbolt

Тандербол, или «удар молнии» тенелюбив. Связанно это с тем, что необычный окрас листовой пластины сохраняется только в тени. Нежная голубоватая зелень с кремовыми перьями по середке быстро выгорают под открытым солнцем. Развивается тандербол долго и вырастает в большой куст высотою до 60см. Стебли же могут вымахать до 120см. Соцветия сиреневые, фиолетовые, белые – собранны в грозди и по форме напоминают колокольчики. Период цветения: июль-август.

Фото: Thunderbolt

First Frost

Пестрые фест фросты с зеленью разнообразного окраса (от кремово-желтого до темно синего и зеленого) станут приятным дополнением к убранству вашего цветника. А белые, сиреневые и голубые  соцветия в форме колокольчика прекрасно дополняют их палитру. 

Высотою фест фросты вырастают до 40см, шириною до 90см. Период цветения: июль-август.

Фото: First Frost

Sum and Substance

Гигант сам энд сабстенс пользуется особой любовью и популярностью у садоводов, возможно благодаря тому, что он достигает в росте 100см, а в диаметре 120см. Участки предпочитает солнечные, хорошо защищенные от ветра. Почва подойдет любая, но предпочтительна богатая на полезные вещества и минералами. Ввиду крупных размеров Сабстенсов не помешает защита от ветра. Выбирая место для посадки, стоит учесть, что место должно быть под стать – таким же большим и просторным.

Фото: Sum and Substance

Captain’s Adventure

Капитан эдвенчур – это, несомненно, одно из самых экзотических решений для вашего сада. Трехцветные зеленовато-желтые листовые пластины с синими мазками по всей поверхности вдобавок имеют еще и белую кайму. Редкие виды обладают такой разнообразной окраской, что делает Капитана яркой звездой в любом ансамбле. 

При выборе места для этого оригинала необходимо учесть, что ему предпочтительны затемненные участки.

Фото: Captain’s Adventure

So Sweet

Со свит отличаются невероятным устойчивым ароматом белых смоцветий и высокой зимоустойчивость, что позволяет их выращивать почти по всей территории нашей стран, за исключением крайнего севера. Размера со свиты среднего.

T-Rex

Ещё один популярный садовый гигант в нашем обзоре. Ти Рекс достигает внушительных 120см роста и ширины в целых 100см. Мощное и большое у ти рекса буквально всё: корневище, овальные листья до 60см, не менее высокие цветоносы с белыми и сиреневыми бутонами.

Почва предпочтительна легкая или средняя суглинистая с низкой кислотность. Места для посадки выбирать желательно тенистые исключительно центральные, но не на переднем, а желательно где-то на заднем плане. Хорошо подходит для оформления водоемов. 

Фото: T-Rex

Посадка

Высаживают  функию в основном рассадой. Многие представители этого рода развиваются относительно медленно, и даже учитывая высокую устойчивостью к холоду, рассадный метод считается самым удобным – он позволяет получить цветение уже в первом году после посадки. Особые предпочтения к почве встречаются редко. Особые требования к месту посадки и уходу у разных видов могут отличаться. Поскольку разница в рекомендациях может быть достаточно значительной – обычно, все нюансы выращивания производитель указывает на пакете с семенами.

Уход

Особого ухода за функией не требуется: достаточно иногда пропалывать сорняки, подрезать кусты для сохранения внешней привлекательности и формы, следить за состоянием почвы – не допускать её пересыхания или застоя воды. Отдельные функии требуют частого полива, особо в период цветения. Удобрения подходят стандартные для цветущих растений – частая подкормка не требуется (только, если почва не совсем бедная).

Подготовка к зиме

В основном функии хорошо переносят похолодания и зимы. Но некоторые из них необходимо мульчировать в конце осени, пока не выпадет снег. Более точно, необходимо это или нет, производитель должен указывать на пакете с семенами.

Вредители и болезни

Все без исключения представители рода отличаются повышенной устойчивостью к вредителям и болезням. Что особенно удобно для начинающих садоводов. Самая большая напасть — это улитки и слизни, которых периодически надо собирать. Но относится это только к самым нежным представителям.

.

фото, разновидности, как выглядит, низкорослые, миниатюрные, красивые

Сорта хосты представлены на садоводческом рынке в большом разнообразии. Декоративное растение пользуется популярностью и эффектно смотрится на участке за счет красивых форм и расцветок.

Как выглядит цветок хоста

Растение под названием хоста — это декоративный травянистый многолетник из семейства Спаржевых. Узнать его можно по черешковым листьям, вырастающим в форме прикорневой розетки, — широким, округлым, узким и ланцетным, прямым и волнистым.

Пышные кусты хосты украшают участок

По высоте хоста может вырастать от 5 до 150 см. Цветки у многолетника трубчатые, поднимаются над листьями на длинных цветоносах. Большинство разновидностей цветут довольно скромно, но есть и сорта с ярким цветением.

Классификация сортов хосты

В садоводстве хоста представлена десятками сортов. Для удобства их принято разделять в соответствии с несколькими классификациями. В частности, хосты группируют:

  • по оттенку — зеленые, желтые, белые, двухцветные и голубые;
  • по оттенку цветения — хосты могут приносить сиреневато-фиолетовые и белые цветки;
  • по высоте — гигантские, средние по размерам, миниатюрные и карликовые;
  • по форме листьев — некоторые растения обладают прямыми ланцетными или овальными листьями, у других они волнистые и текстурированные.

Классификаций у растения много — по размерам, цвету, форме

В ландшафтном дизайне многолетник ценится преимущественно за декоративную листву, а цветение отходит на второй план.

Разновидности хосты

Любой из сортов хосты принадлежит к одному из основных видов. Различия между видами довольно заметные, поэтому даже начинающему садоводу просто определить, к какой группе относится выбранный многолетник.

Подорожниковая

Узнать вид можно по крупным блестящим листовым пластинам округлой формы и большим белым цветкам до 12 см в длину. Цвет подорожниковой разновидности светло-зеленый.

Среди сортов можно отметить:

  • Ханибеллз;

    Ханибеллз — типичный представитель подорожникового вида

  • Грандифлора.

    Грандифлора — красивый куст подорожниковой хосты

По высоте вид обычно не превышает 45 см и может раскидываться до таких же размеров в ширину.

Белоокаймленная

Характерная особенность вида — широкая белая каемка по краям сочно-зеленых листьев. К известным сортам относятся:

  • Маргината — сорт с выраженной неровной каемкой

  • Алаказам.

    Волнистость листвы Алаказам сочетается с двухцветным оттенком

Многолетник вырастает в среднем не более 30 см в высоту и 45 см в диаметре.

Прямолистная

Многолетник отличается хорошо развитыми, прямыми, направленными вверх зелеными листьями и крупными сиреневыми цветками. Сорта прямолистного вида представлены не слишком широко, среди них можно назвать:

  • Ректифолиа, прямолистный вид в его неизменной форме;

    Прямолистный вид легко узнать по листовым пластинам

  • Хионеа, или Китайская.

    Хионеа — разновидность прямолистной хосты

Вид относится к среднерослым и может достигать 85 см в высоту и 70 см в ширину.

Вздутая

Яркая особенность вида — зеленые листья вытянутой, слегка сердцевидной формы с заостренным кончиком. Многолетник цветет светло-фиолетовыми соцветиями, среди знаменитых разновидностей числятся:

  • Вентрикоза;

    Вентрикоза — листва зеленая и рельефная

  • Унивитата.

    Унивитата — образец вздутого вида

Высота растения может превышать 1 м, однако есть и менее рослые сорта

Ланцетолистная

Разновидность легко узнать по темно-зеленым заостренным листовым пластинам, длинным и блестящим. Цветет многолетник в основном фиолетовыми цветками, среди сортов можно отметить:

  • Кабитэн;

    Кабитэн легко узнать по ланцетной листве

  • Битси Грин.

    Битси Грин — известный ланцетный сорт

По высоте редко поднимается выше 40 см.

Волнистая

У этой разновидности продолговатые листовые пластины обладают необычной формой, они как будто изгибаются крупными волнами. По цвету разновидность может быть зеленой, двухцветной, желтоватой, среди сортов отмечают:

  • Вариегата;

    Волнистая Вариегата завивается очень сильно

  • Со Свит.

    Со Свит — сорт с волнистыми листками

Высота зависит от конкретного растения, но максимально хоста поднимается до 80 см.

Хоста Зибольда

Отличается плотной, крупной листвой голубоватого цвета с морщинистой поверхностью. Среди разновидностей можно упомянуть:

  • Элеганс;

    Элеганс — типичный представитель хосты Зибольда

  • Пауль’с Глори.

    Пауль’с Глори — очень красивый разноцветный сорт

Высота растения составляет около 40 см.

Хоста Форчуна

Растение с удлиненными сизоватыми или зелеными листьями приносит цветки лилового оттенка. Известные разновидности:

  • Ауреа;

    Ауреа может обладать салатовыми или сизоватыми листьями

  • Гиацинтина — величественный сорт изумрудной окраски

По высоте куст может достигать 90 см, в диаметре раскидывается в среднем на 50 см.

Курчавая

Разновидность отличается волнистыми по краям листовыми пластинами, обычно с зеленым центром и белой окантовкой. Среди сортов можно перечислить:

  • Медиовариегата;

    Листва Медиовариегаты курчавая и необычная

  • Альбомаргината.

    Альбомаргината имеет красивую полоску по краю листа

Над землей растение возвышается в среднем на 70 см.

Лучшие сорта хосты

Чтобы удачно выбрать многолетник для сада, следует ознакомиться с популярными сортами. Перечислить все разновидности очень трудно, но можно выделить самые привлекательные в каждой категории.

Сорта низкорослой хосты

Невысокий многолетник используют в основном в бордюрах и миксбордерах на переднем плане. Популярные сорта:

  1. Лейксайд Литл Тафт. Растение поднимается до 25 см над грунтом, листья у него вытянутые, слегка волнистые, с заостренным кончиком. Весной листовые пластины светло-зеленые по краям и желтоватые в центре, а летом становятся беловатыми в середине и ярко-зелеными по краю.

    Лейксай Литл Тафт — яркие листья устремлены вверх

  2. Делия. Сорт поднимается на 15 см над землей, окраска листьев зелено-желтая в сердцевине и зеленая по краям.

    Листовые пластины Делии темнее по краям

Яркая расцветка листьев делает растения заметными элементами композиции, несмотря на малые размеры.

Сорта миниатюрных хост

Среди низкорослых многолетников принято особенно выделять карликовые сорта:

  1. Блю Айс. Растение приподнимается всего на 8 см над землей, листья у сорта голубоватого оттенка, а по ширине кусты раскидываются на 20 см.

    Блю Айс — крохотный подвид хосты

  2. Спарки. Высота сорта в среднем составляет 10 см, диаметр около 20 см. Цвет листьев — насыщенно-зеленый с желтым окаймлением по краям.

    Спарки — миниатюрный сорт для сада и дома

Карликовые многолетники часто используют при создании миниатюрных японских садов. Выращивать их можно в горшках в домашних условиях.

Сорта средней хосты

Среднерослые многолетники пользуются в ландшафтном дизайне спросом. Их часто высаживают вдоль садовых дорожек, украшают пространство возле стен дома.

Распространенные сорта:

  1. Джун. Вырастает сорт в среднем до 40 см, листья у него плотные, синевато-зеленые с желтыми оттенками. По диаметру раскидывается до 70 см.

    Джун — очень известный подвид

  2. Брим Кап. Декоративное растение обладает полуовальными рифлеными листьями со светло-желтой окантовкой и зеленой срединой. Средняя высота куста составляет около 35 см, разрастаться кусты могут до 75 см.

    Яркий окрас Брим Кап привлекает внимание

Средние по росту разновидности сажают как в одиночных композициях, так и в группах. Разные сорта можно сочетать между собой для получения особенно красивых клумб.

Сорта высокорослой хосты

Особенное место в садовом дизайне занимает крупная хоста, способная достигать до 1 м высоты и больше. Самые распространенные сорта:

  1. Дино. Средняя высота растения составляет около 120 см, листья у многолетника округлые, насыщенно-зеленого цвета со светлой каймой по краям.

    Дино возвышается на участке больше чем на 1 м

  2. Блю Мамонт. Обладает рифлеными крупными листьями голубовато-зеленого цвета, по форме листья овальные. Поднимается на высоту около 90 см.

    Блю Мамонт — очень раскидистое и крупное растение

При помощи таких кустов можно сформировать невысокую изгородь, декорировать широкое незанятое пространство.

Сорта крупнолистной хосты

Интерес для садоводов представляют не только высокие хосты, но и сорта с крупными листьями. Широкие листовые пластины притягивают к себе взгляд, особенно если окраска у них необычная.

Популярные сорта вида:

  1. Сэм энд Сабстенс. Крупный сорт до 1 м, характеризуется округлыми

    Сэм энд Сабстенс ценят за огромную листву

  2. Эмпресс Ву. Еще один высокий сорт до 1,5 м с листьями до 50 см. Жилистые, темно-зеленые, они слегка вытягиваются вверх. Весной на листьях различим голубоватый оттенок.

    Ширина листовых пластин Эмпресс Ву достигает 0,5 м

Важно! Крупнолистные хосты в дизайне сада часто высаживают на среднем уровне миксбордеров. Такие многолетники хорошо заполняют пространство и удачно декорируют пустующие участки.

Сорта хосты с волнистыми листьями

Некоторые из многолетников радуют необычной структурой листьев. По краям пластин идут мелкие или крупные волны, поверхность сильно гофрирована.

Выделяют многолетники:

  1. Джейд Каскад. Высокий многолетник вытягивается в среднем до 110 см, но внимание привлекает своими листовыми пластинами. Крупные и зеленые, они прорезаны глубокими поперечными прожилками, а по их краям проходит крупная волна, к тому же сами листья расположены друг над другом каскадом.

    Джейд Каскад — листва у подвида спускается фонтаном

  2. Кост ту Кост. Средний по размерам многолетник поднимается на 90 см, обладает сердцевидными листьями с рифленой поверхностью и небольшими красивыми волнами по краям. По оттенку листовые пластины желто-зеленые.

    Кост ту Кост отличается мелкой волнистостью листвы

При высадке в саду волнистые сорта задерживают на себе взгляд и заставляют внимательнее присмотреться к композиции, элементом которой они служат.

Сорта хосты с нестандартной окраской листьев

Большинство хост обладают светлой, темной зеленой или слегка желтоватой листвой, иногда с белыми полосами по краям или в середине. Но есть и разновидности с ярким оригинальным оттенком — насыщенно-желтым, белым или голубым:

  1. Вайт Фезер. Очень эффектный сорт с молочно-белой молодой листвой. К середине лета хоста начинает зеленеть, однако в первые месяцы выделяется в саду очень заметным белым пятном.

    Вайт Фезер — уникальный белый сорт

  2. Голден Медальон. Растение высотой до 50 см обладает листвой округлой формы, весной желтовато-зеленой, а после середины июля — практически чисто-желтой.

    Голден Медальон радует насыщенной желтизной

  3. Кадет. Необычная хоста изумрудно-голубого цвета ростом до 50 м, с крупными рифлеными листовыми пластинами.

    Кадет — синеватый сорт

Внимание! Для сохранения оригинальной расцветки белые и желтые хосты рекомендуется высаживать на освещенных участках. Голубые сорта лучше всего чувствуют себя в тени.

Сорта цветущей хосты

Большинство хост цветет сиреневыми, лиловыми или фиолетовыми цветками. По внешнему виду они довольно невзрачны и не имеют особой ценности. Но некоторые сорта способны порадовать именно интересным цветением:

  1. Инвайнсибл. Ярко-зеленая хоста с вытянутой по форме листвой в июле и августе приносит обильные голубоватые цветки в форме колокольчиков. Возвышается растение на 50 см над грунтом, в цветущем виде выглядит очень нарядно.

    Инвайнсибл дает голубоватые и сиреневые цветы

  2. Фрайд Грин Томатос. Оливково-зеленый многолетник с августа по октябрь цветет лавандовыми цветками с приятным ароматом. Невысокое растение до 35 см украшает клумбы в тот период, когда большинство многолетников уже заканчивают цветение.

    Фрайд Грин Томатос цветет очень обильно

Достоинство цветущих хост состоит в их повышенной декоративности. Использовать такие сорта можно более широко, комбинируя их с растениями, цветущими в тот же период.

Сорта хосты с белыми цветами

Особенного упоминания заслуживают многолетники, выпускающие яркие белые цветки:

  1. Роял Стандард. Среднерослая хоста, около 70 см, обладает овальными зелеными листьями. В августе растение приносит многочисленные белоснежные цветки с жасминовым ароматом, которые держатся вплоть до октября.

    Роял Стандард — редкий подвид с белым цветением

  2. Блю Энджел. Красивое голубовато-зеленое растение возвышается до 1 м, а с июля приносит обильные белые с легким фиолетовым оттенком цветки. Период максимальной декоративности продолжается до сентября.

    Окраска у Блю Энджел зеленовато-синяя, а цветки белые

Цветущие белыми оттенками сорта высоко ценятся, поскольку цветки особенно ярко выделяются на фоне зеленых и голубоватых листьев.

Новые сорта хосты на 2020 год

Селекционеры регулярно выводят свежие сорта многолетнего растения. В 2020 году садоводческие магазины анонсируют новые разновидности хост:

  1. Буллет Пруф. Новый вид обладает толстыми синеватыми листьями, по высоте составляет около 45 см, подходит для выращивания на теневых и освещенных участках.

    Буллет Пруф — один из новых синеватых сортов

  2. Кристмас Пейджант. Среднерослая новинка до 70 см отличается темно-зелеными, сильно гофрированными листовыми пластинами с желтоватым окаймлением по краям.

    Кристмас Пейджант — декоративная новинка из «рождественской» серии

Требования к уходу у новинок стандартные, поэтому для садоводов не составит труда вырастить молодые сорта.

Самые красивые сорта хост

Любые хосты очень красивы в ландшафтном дизайне. Но можно выделить особенно любимые садоводами разновидности:

  1. Фейерверк. Невысокий многолетник около 35 см с узкими волнистыми листьями, направленными вертикально. Окраска у листьев

    Фейерверк похож на бело-зеленый салют над землей

  2. Либерти. Крупный куст до 70 см с голубовато-зеленой листвой с яркой кремово-желтой каемкой, листья большие и плотные.

    Либерти — очень яркий и сочный подвид

Красота того или иного вида остается субъективным понятием. При выборе нужно ориентироваться только на собственный вкус.

Редкие сорта хост

Некоторые разновидности очень красивы, но встретить их на дачном участке можно нечасто:

  1. Огонь и Лед. Многолетник ростом до 40 см, с декоративными листьями, где белый центр сочетается с темно-зелеными краями.

    Огонь и Лед — красивый, но редкий сорт

  2. Спартан Арроу. Очень необычный вид с длинными узкими листьями с темной зеленой окраской и сильно волнистыми краями. Возвышается над грунтом на 20 см.

    Узнать Спартан Арроу можно по сильно волнистой листве

У многих двухцветных многолетников листья меняют свою окраску под воздействием света, поэтому сохранить полную декоративность растения при выращивании в саду бывает трудно.

Гибридные сорта хосты

В основном сортовое разнообразие многолетника представлено именно гибридами:

  1. Бич Бой. Хотя листья у растения овальные, окраска у них двухцветная, что более типично для волнистых и ланцетовидных видов — с желтоватой серединой и яркой зеленью по краям. По высоте достигает 45 см.

    Бич Бой — популярный в саду гибрид

  2. Шуга энд Спайс. Среднерослый куст около 50 см интересен тем, что светлая узкая каемка на его зеленых листьях нерегулярная и прерывистая, а листья при этом слегка гофрированные. Многолетник похож одновременно и на подорожниковую, и на белоокаймленную хосту.

    Шуга энд Спайс отличается блестящими листьями с желтой каймой

Гибридные растения сочетают в себе характерные признаки разных видов, и именно поэтому так привлекательны.

Правила выбора сорта

При выборе декоративного многолетника нужно опираться главным образом на свои предпочтения. Но есть несколько общих правил:

  1. Для тенистых участков сада рекомендуется выбирать многолетники с зелеными или голубоватыми листьями. На солнце синие виды сажать

    Темные хосты лучше переносят притененные участки

  2. Желтые и белые многолетники можно сажать на освещенных участках. На солнце они выглядят более выигрышно и к тому же лучше растут, хотя легкое притенение оставаться все равно должно.

    На свету желтые и молочно-белые сорта хорошо сохраняют цвет

Совет! При выборе хосты нужно учитывать размеры взрослого куста. Некоторые виды так и остаются карликовыми, другие вытягиваются больше 1 м над землей и могут закрыть соседние растения.

Заключение

Сорта хосты — это целый мир разнообразных и не похожих друг на друга декоративных растений. На участке при помощи многолетника можно создать очень эффектные композиции, и крупные, и совсем миниатюрные.

Виды и сорта культуры хосты (Часть 2)

Материал подготовили:

Жбанова Ольга Владимировна
Исполнительный директор Ассоциации садоводов России (АППЯПМ), ведущий специалист АППЯПМ по ягодным культурам

Дорохова Е.В.
Специалист Ассоциации производителей плодов, ягод и посадочного материала (АППЯПМ) по апробации и сертификации посадочного материала плодовых и ягодных культур

С использованием материалов сайта ogorod.ru

Виды и сорта культуры хосты (Часть 2)

Хоста – незаменимое растение для сада. Она неприхотлива, теневынослива, красива. Хотя на первый взгляд различные виды и сорта хост могут показаться практически идентичными, на самом деле их огромное множество.

Фёрст Мэйт

(First Mate)

Хоста Фёрст Мэйт резко выделяется на фоне остальных хост необычной формой листьев: они длинные, заостренные, клиновидной формы. Кусты растения невысокие, миниатюрные.

Окраска листьев Окраска цветков Высота куста (см) Ширина куста (см) Сроки цветения
Зеленые по краям, кремово-желтые в центре Лиловые 22-25 30-60 Июль-август

Хоста горная Ауреомаргината

(Hosta montana Aureamarginata)

Это роскошное растение примечательно фонтанообразной формой куста и зелено-желтой окраской листьев. Горную хосту часто путают с высокой из-за внушительных размеров обоих видов.

Окраска листьев Окраска цветков Высота куста (см) Ширина куста (см) Сроки цветения
Золотисто-желтые с зеленой окантовкой Лавандовые 70-80 150-170 150-170

Хоста декоративная

(Hosta decorata)

Хоста декоративная также попала в нашу садовую культуру из Японии. Листья ее чаще всего матовые с наружной и блестящие с внутренней стороны, по краю с белой каймой. Исключение составляет лишь форма Нормалис (Normalis) с одноцветными зелеными листьями.

Эта хоста растет практически на любых типах почвы, славится высокой морозостойкостью. Единственное, чего стоит опасаться – это нашествия слизней и улиток, которых привлекает сочная листва растения.

Окраска листьев Окраска цветков Высота куста (см) Ширина куста (см) Сроки цветения
Зеленые с белой каймой либо без нее Лавандовые 30-40 60-70 Июль-август

Хоста Зибольда

(Hosta sieboldiana)

Родина хосты Зибольда – японский остров Хонсю. Растения этого вида отличаются широкими, округлыми, сердцевидными листьями с сизым налетом. Высота кустов хосты Зибольда небольшая – около 35-40 см. Этот вид интересен разнообразием красивых гибридных сортов.


Элеганс

(Elegans)

Не будет преувеличением назвать Элеганс одним из самых восхитительных сортов хосты. Куст этого растения крупный: высота составляет в среднем 65 см, ширина может достигать 130 см.

Главная изюминка хост этого сорта – большие сердцевидные листья нефритового оттенка длиной до 37 см. Цветки хосты Элеганс белоснежные, по форме напоминают трубчатые лилии.

Окраска листьев Окраска цветков Высота куста (см) Ширина куста (см) Сроки цветения
Нефритовые Белоснежные 65-90 90-130 Июль-август

Хоста малая

(Hosta minor)

Хоста малая – длиннокорневищная разновидность хосты с компактной надземной частью. Высота куста – всего 10-15 см.

Этот вид часто относят к одной из форм хосты вздутой.


Блю Кадет

(Blue Cadet)

Растения сорта Блю Кадет отличаются сизоватым оттенком листвы. Как и другие хосты этого вида, они миниатюрны и отлично подходя для использования в рокариях.

Окраска листьев Окраска цветков Высота куста (см) Ширина куста (см) Сроки цветения
Сизые Фиолетовые 10 13-15 Июль-август

Хоста подорожниковая

(Нosta plantaginea)

Это старинная разновидность хосты, которая была привезена в европейские сады из Китая еще в XVIII веке. Она примечательна округлыми блестящими листьями и крупными цветками, размер которых может достигать 12 см.

Хоста подорожниковая не боится суровых морозов, устойчива ко всевозможным болезням и вредителям и не доставит много хлопот.

Окраска листьев Окраска цветков Высота куста (см) Ширина куста (см) Сроки цветения
Светло-зеленые Белые 30-45 45-60 Август-сентябрь

Хоста прямолистная

(Нosta rectifolia)

Природный ареал этой хосты – Дальний Восток России и Япония. Растение красивое, мощное. Листья почти прямые, направлены практически вертикально. Цветки очень крупные, эффектные, насыщенного сиреневого цвета.

Хоста прямолистная может расти в полутени, но предпочитает хорошее освещение. Желательно использовать ее на клумбах, в миксбордерах, но не высаживать в приствольных кругах.

Окраска листьев Окраска цветков Высота куста (см) Ширина куста (см) Сроки цветения
Зеленые Сиреневые 70-85 60-70 Июль-август

Хоста Форчуна

(Hosta fortunei)

Китайская хоста Форчуна – позднецветущая разновидность. Кусты средней высоты, достаточно компактные. Листья удлиненные, узкие, обычно однотонные, зеленого оттенка. Исключение – форма Альбомаргината (Albomarginata) с белой каймой по периметру листовой пластины.

Окраска листьев Окраска цветков Высота куста (см) Ширина куста (см) Сроки цветения
Сизовато-зеленые, иногда с белой каймой Лиловые 50-90 60-70 Август-сентябрь

Хоста яйцевидная

(Hosta ovata)

Родина хосты яйцевидной – Япония, Корея, Китай, Дальний Восток. Кустики небольшие, шарообразные, средней высоты. У этой хосты – несколько форм, которые отличаются друг от друга в основном окраской и формой листьев:

  • Золотоперистая (Aureo-variegata). Широкие листья овальной формы золотистого оттенка, сине-фиолетовые соцветия.
  • Широколистная (Latifolia). Широкие овальные листья зеленого цвета с волнистым краем, сиреневые соцветия.
  • Двуцветная (Discolor). Крупные удлиненные листья темно-зеленого цвета, лиловые соцветия.
Окраска листьев Окраска цветков Высота куста (см) Ширина куста (см) Сроки цветения
Зеленые Лиловые 30-40 40-50 Август-сентябрь

устойчивых сортов растений

Устойчивый

Завод
Разновидности

Садоводы должны использовать виды и сорта растений, которые хорошо адаптированы к pH, дренажу или температуре местной почвы. Кроме того, следует выбирать растения, устойчивые к местным вредителям. Устойчивость растений-хозяев — это термин для различения сортов растений, которые проявляют меньшее повреждение насекомыми по сравнению с другими сортами при аналогичных условиях выращивания и популяции вредителей.Устойчивость растения-хозяина часто интерпретируется как «невосприимчивость к повреждению насекомыми». На самом деле устойчивость растения-хозяина может действовать несколькими способами, и лишь немногие растения полностью невосприимчивы к повреждению насекомыми.

Есть три основных способа, которыми работает устойчивость растения-хозяина: толерантность, непредпочтение и антибиотик.

Терпимость — это присутствие, если штамм растений выживает или дает лучше, чем стандартный сорт, когда присутствует такое же количество вредителей.Терпимость проявляется, когда большие популяции насекомых содержатся на растении без значительного ущерба.

Непредпочтение возникает, когда сорт подвергается атаке реже, чем стандартный сорт, даже если вредители могут выбрать любой сорт. Некоторые разновидности могут быть менее «вкусными» для насекомых-вредителей или могут обладать определенными физическими или химическими свойствами, которые препятствуют кормлению насекомых или откладыванию яиц.

Антибиоз возникает, когда у растения есть физические или химические свойства, которые препятствуют росту вредителей.Растения с жесткими стеблями или с химическими веществами, которые трудно переваривать вредителями, являются примерами антибиотиков растений.

Эти факторы нелегко распознать на конкретном разнообразии растений. Результатом устойчивого сорта является то, что растение просто растет или дает лучше, чем другой сорт.

Перед покупкой семян или растений ознакомьтесь с каталогами семян, чтобы узнать о устойчивых сортах, которые будут хорошо расти в вашем районе.Также уточняйте у местных агентов по распространению семян, а также у местных дилеров и питомниководов, чтобы узнать о лучших сортах для выращивания. Ваш опыт работы с разными сортами подскажет, какие из них лучше всего подходят для вашего сада.

Начало вредителей и болезней | Дом

границ | Микробиом растений и его связь с здоровьем растений: виды-хозяева, органы и Pseudomonas syringae pv. actinidiae, формирующая бактериальные филлосферные сообщества растений киви

Введение

Растительный микробиом играет решающую роль в здоровье и продуктивности растений и, таким образом, получил значительное внимание в последние годы (Turner et al., 2013). Основное внимание в исследованиях микробиома растений уделяется модельным растениям, таким как Arabidopsis thaliana , а также важным экономическим видам сельскохозяйственных культур, включая ячмень ( Hordeum vulgare ), кукурузу ( Zea mays ), рис ( Oryza sativa). ), сои ( Glycine max ), пшеницы ( Triticum aestivum ), тогда как фруктовым культурам и древесным породам уделяется меньше внимания (Busby et al., 2017). Микробиомы растений формируются как связанными с растениями (т.е., генотип, орган, виды, состояние здоровья и т. д.) и экологические факторы (т. е. управление, землепользование и климат) (Bringel and Couée, 2015). Хотя в некоторых исследованиях сообщается, что состояние здоровья растений отражается или связано с его микробиомом (Berendsen et al., 2012; Turner et al., 2013; Berg et al., 2014), этот аспект на самом деле все еще неясен и требует дополнительных эмпирических исследований. свидетельство. Таким образом, в отношении видов плодовых культур до сих пор неясно, как инфекционные заболевания изменяют микробиом инфицированных органов.

Pseudomonas syringae pv. actinidiae (Psa) является возбудителем бактериального рака киви, который является основной угрозой для производства киви во всем мире (Scortichini et al., 2012; Vanneste, 2012). Патоген может инфицировать растения Actinidia chinensis и A. deliciosa , два наиболее важных коммерческих вида (Donati et al., 2014). Пока не обнаружено устойчивого генотипа, но, как правило, сорта A. deliciosa считаются менее восприимчивыми, чем сорта, принадлежащие к A.chinensis (Spinelli et al., 2011). Перед тем, как заразить растение, возбудитель прорастает на эпифитных поверхностях цветков и листьев актинидии . После этой эпифитной фазы заражение происходит через естественное открытие таких устьиц на листьях или стиллярных тканях на цветках (Donati et al., 2018) или через естественные раны, такие как сломанные трихомы (Spinelli et al., 2011). Как только Psa попадает в ткани хозяина, инфекция быстро становится системной, что приводит к гибели растения-хозяина (Renzi et al., 2012; Scortichini et al., 2012; Донати и др., 2014). Таким образом, понимание взаимодействия Psa с микробным сообществом филлосферы может предоставить важную информацию для разработки инновационных, эффективных и долгосрочных стратегий контроля. На сегодняшний день не разработаны устойчивые и полностью эффективные методы борьбы с этим заболеванием, и борьба в основном зависит от использования медных составов (Collina et al., 2016; Scortichini, 2016). Однако растущая обеспокоенность экологическими рисками, вызванными широким использованием ксенобиотических пестицидов, побудила такие учреждения, как Европейская комиссия, разработать правила, ограничивающие их использование (Постановление Комиссии [EC], 2008.396/2005 / EC, 149/2008 / EC). Устойчивая и экологически безопасная альтернатива химическим пестицидам для борьбы с болезнями в филлосфере — это использование агентов биологической борьбы (BCA) (Wicaksono et al., 2018). Действительно, филлосфера представляет собой экологическую нишу, имеющую ключевое сельскохозяйственное и биологическое значение (Whipps et al., 2008; Vorholt, 2012), а бактериальное эпифитное сообщество может положительно влиять на здоровье, физиологию и экологическую пригодность растений (Kim et al., 2011; Vorholt, 2012; Dees et al., 2015). Сообщается, что несколько видов эпифитных бактерий, выделенных из филлосферы, являются сильными конкурентами патогенов растений, таким образом действуя как BCA (Volksch and May, 2001). Помимо прямой конкуренции за ограниченное пространство и питательные вещества, некоторые BCA также могут подавлять рост патогенов, секретируя антимикробные соединения (например, Pantoea agglomerans, Lactobacillus plantarum ) или вмешиваясь в систему передачи сигналов патогенов (Volksch and May, 2001). . Наконец, известно, что другие эпифитные бактерии обладают активностью, способствующей росту растений, и вызывают естественную устойчивость растений к патогенам (Ryu et al., 2003; Оттесен и др., 2013; Растоги и др., 2013). Для борьбы с Psa штаммы Pseudomonas fluorescens, Bacillus subtilis, Bacillus amyloliquefaciens и, совсем недавно, Lactobacillus plantarum были протестированы как возможные BCA (Gould et al., 2015; Collina et al., 2016; Yakhin et al., др., 2017).

Скрининг и отбор новых BCA были в основном сосредоточены на идентификации отдельных видов бактерий, эффективных в борьбе с конкретным патогеном. Однако в естественных условиях бактерии живут в сообществах, регулируемых межвидовой передачей сигналов (Ryan and Dow, 2008), и, таким образом, современный подход к усилению роста и здоровья растений заключается в выяснении влияния небольших микробных консорциумов на патогены или на устойчивость растений-хозяев. индукция (Sarma et al., 2015). В нескольких исследованиях было подчеркнуто, что по сравнению с использованием отдельных полезных видов применение микробных консорциумов может повысить эффективность, надежность и стабильность роста и укрепления здоровья в более широком диапазоне условий окружающей среды (Stockwell et al., 2011). С этой точки зрения положительное влияние на здоровье растений является результатом комбинированного и синергетического взаимодействия нескольких видов бактерий, каждый из которых обладает определенным положительным эффектом (Kim et al., 2011; Sarma et al., 2015).

Понимание динамики и эволюции бактериального сообщества в филлосфере может также предоставить важную информацию о других факторах, влияющих на процесс инфицирования Psa. Фактически, симбиотические взаимодействия между различными видами микробов, ведущие к патогенному консорциуму, могут увеличить заболеваемость и развитие болезни (Lamichhane and Venturi, 2015). Растущее количество данных свидетельствует о том, что патогены не действуют независимо, но их вирулентность опосредована их взаимодействием с другими патогенами (Singer, 2010; Lamichhane and Venturi, 2015).Это явление привело исследователей к развитию идеи патобиома, то есть сообщества, в котором патогены участвуют в сложных взаимодействиях со своей биотической средой (Vayssier-Taussat et al., 2014). Важность взаимодействия между патогенами хорошо известна для здоровья человека (Singer, 2010). Например, в области медицины термин «синдром» указывает на синергетические взаимодействия между заболеваниями (Singer and Clair, 2003). Несмотря на то, что некоторые случаи совместного появления бактериальных патогенов были описаны в растениях, влиянию взаимодействия патогенов на болезни растений уделялось гораздо меньше внимания (Kùdela et al., 2010; Ламичхане и Вентури, 2015). В киви возбудителей Pseudomonas , таких как P. syringae pv. syringae и P. viridiflava , часто встречаются вместе, но их взаимодействие до сих пор неясно (Balestra et al., 2008; Petriccione et al., 2017).

Основными целями данного исследования были (i) изучение бактериальных филлосферных сообществ на листьях и цветках двух видов киви ( A. deliciosa, сорт Hayward и A.chinensis cv. Hort16A) с использованием Illumina секвенирования вариабельных областей V3 и V4 рибосомного гена 16S; (ii) проверить относительную важность видов растений, органов и инфекции Psa в формировании бактериальных филлосферных сообществ; (iii) количественная оценка (с помощью количественной полимеразной цепной реакции в реальном времени, кПЦР) численности в различных органах растений возбудителей Pseudomonas (т.е. Psa, P. syringae pv. syringae и P. viridiflava ) и BCA (т.e., Lactobacillus plantarum, Pantoea agglomerans, Bacillus subtilis, B. amyloliquefaciens и P. fluorescens ) в отношении состояния здоровья растений. Экспериментальный подход позволил нам выявить возможный вклад видоспецифичного микробиома в различную восприимчивость A. deliciosa cv. Hayward и A. chinensis cv. Hort16A в Psa.

Материалы и методы

Сбор проб

Листья и цветки собраны у A.Deliciosa cv. Hayward и A. chinensis cv. Растения Hort16A выращивают в коммерческих садах, расположенных в регионе Фаэнца (Эмилия-Романья, Италия). В этих садах средняя заболеваемость в предыдущем сезоне составляла 8 и 21% в Хейворде и Hort16A, соответственно. При появлении всходов и начале цветения был проведен обширный скрининг, чтобы отличить незараженные растения от инфицированных. С этой целью отбирали образцы по 10 цветков и 10 листьев на каждом растении и оценивали загрязнение Psa в соответствии с Gallelli et al.(2014). Изучение микробного сообщества филлосферы проводили отдельно на незараженных от зараженных растениях. Для этого отбор образцов производился при полном цветении для обоих видов киви. Были применены стандартные обрезка, удобрение и орошение фруктовых садов, а в течение 6 месяцев, предшествовавших отбору проб, химические или биологические пестициды не применялись. Более того, сады опылялись естественным путем без дополнительного внесения пыльцы. Листья отбирали группами по 10 образцов на каждое растение, произвольно выбранных либо на незараженных, либо на инфицированных лозах.Чтобы свести к минимуму влияние положения и возраста листьев, собирали только третий полностью развернувшийся лист с каждого побега того же возраста. Образцы цветов отбирали при раскрытии пыльников группами по 5 на растение, случайным образом выбираемых либо на незараженных, либо на инфицированных лозах. Каждый образец листа или цветка промывали 10 или 15 мл стерильного 10 мМ раствора MgSO 4 соответственно. Чтобы сконцентрировать бактериальную нагрузку, для всех образцов в определенной группе использовали один и тот же промывочный раствор. Для извлечения всех бактерий, связанных с филлосферой, промывку проводили в течение 15 минут при осторожном перемешивании (100 об / мин) при температуре 4 ° C, чтобы избежать механического повреждения тканей и размножения бактерий.Чтобы проверить эффективность процесса промывки, каждый промытый лист или цветок переносили в новый стерильный раствор MgSO 4 и снова обрабатывали, как описано ранее. Этот промывочный раствор последовательно высевали на среду LB-агар. Наконец, группирование различных образцов в соответствии с наличием Psa было подтверждено путем гомогенизации каждой группы листьев или цветов в партии и обработки в соответствии с Gallelli et al. (2014).

Экстракция и секвенирование ДНК

Библиотеки

были подготовлены с использованием протокола подготовки библиотеки метагеномного секвенирования 16S компании Illumina (Сан-Диего, Калифорния, США), который позволяет секвенировать вариабельные области V3 и V4 гена 16S рРНК.Вкратце, промывные растворы осаждали центрифугированием при 20000 × g в течение 20 минут при 4 ° C, затем супернатант отбрасывали. Гранулы соединяли, немедленно замораживали в жидком азоте и хранили при -80 ° C. Из замороженных гранул геномную ДНК экстрагировали и очищали с использованием почвенного набора NucleoSpin ® (Macherey-Nagel GmbH & Co. KG, Düren, Германия) в соответствии с инструкциями производителя. После определения ее концентрации и чистоты с помощью спектрофотометра, экстрагированная геномная ДНК была использована в качестве матрицы для амплификации областей V3 – V4 с помощью 16S Amplicon PCR Forward = 5 ′ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG и ReverseT = 5 ′ GTCTCGACTGATGGCAGGAT, предложенного протоколом PCRTCAGTAGGGCCCGAT, в соответствии с протоколом PCRTCAGTAGGGCCCGATCGTAG

Продукты ПЦР

очищали с использованием гранул Agentcourt ® AMPure ® XP (Beckman Coulter Company, Бреа, Калифорния, США). Качество конечных продуктов оценивали с помощью Bioanalyzer 2100 (Agilent Technologies, Вальдбронн, Германия) и количественно определяли с помощью флуорометра Qubit ® (Thermo Fisher Scientific, Уолтем, Массачусетс, США) в соответствии с протоколом производителя. Ампликоны были присоединены к двойным индексам и адаптерам секвенирования Illumina с использованием набора Nextera XT Index Kit (Illumina Inc., Сан-Диего, Калифорния, США), объединенные в равных пропорциях и секвенированные парным концом в Illumina MiSeq (Illumina Inc., Сан-Диего, Калифорния, США) в IGA Technology Services (Удине, Италия). Чтобы предотвратить проблемы с фокусировкой и фазированием из-за секвенирования библиотек с «низким разнообразием», таких как ампликоны 16S, 30% генома PhiX было добавлено в объединенную библиотеку.

Биоинформатический анализ

Необработанные чтения были сначала обработаны с помощью Trimmomatic (Bolger et al., 2014) для удаления некачественных чтений с использованием скользящего окна длиной 5 п.н. со средним показателем phred ≥ 20.Последовательности короче 100 оснований отбрасывали. Последовательности 16S рРНК анализировали с использованием программного пакета Mothur версии 1.35.1 (Schloss et al., 2009). Считывания парных концов были собраны и сопоставлены с базой данных последовательностей рРНК SILVA 16S (Pruesse et al., 2007). Последовательности были очищены от шума, чтобы удалить ошибку секвенирования с помощью команды «pre.cluster», а химерные последовательности были удалены с использованием алгоритма Uchime (Edgar et al., 2011), реализованного в Mothur. Последовательности были сгруппированы в OTU с 96% идентичностью последовательностей с использованием методов кластеризации ближайшего соседа.Последовательности были классифицированы с использованием справочной базы данных Ribosomal Database Project (RDP), предоставленной в Mothur. OTU, которые были одиночными и дуплетонами, были удалены. Образцы были нормализованы до 6886 последовательностей каждая (размер наименьшего образца), чтобы гарантировать, что на анализ не повлияла разница глубин секвенирования. Данные секвенирования бактериального гена 16S рРНК Illumina депонированы в библиотеке NCBI BioProject (доступ: PRJNA472855, ID: 472855). Таксономическая таблица бактерий (с данными об относительной численности бактерий) приведена в дополнительной таблице S1.

Анализ КПЦР

Наборы праймеров, использованные в этом исследовании, перечислены в таблице 1. Новые наборы праймеров были разработаны на основе L. plantarum WCFS1 и P. syringae pv. actinidiae Последовательности RC3 доступны в Национальном центре биотехнологической информации (NCBI). Соответствующие праймеры были созданы с использованием онлайн-программы Primer3Plus (Untergasser et al., 2012). Программное обеспечение поиска BLAST (Basic Alignment Search Tool) использовалось для проверки специфичности каждого набора праймеров.Свойства каждого праймера проверяли с помощью анализатора Oligo 3.1. Специфичность праймера была подтверждена анализом кривой плавления и ПЦР по конечной точке, выполненной с использованием того же протокола, принятого для кПЦР (см. Ниже), с использованием фермента AmpliTaq Gold ® 360 и Master Mix (Thermo Fisher Scientific, Waltham, MA, США).

ТАБЛИЦА 1. Праймеры, использованные в этом исследовании, чтобы выявить присутствие указанных видов бактерий.

Анализ

кПЦР выполняли с использованием быстрой мастер-смеси Sybr Green (Applied Biosystem, Foster City, Калифорния, США) в 96-луночном спектрофлуориметрическом термоциклере StepOnePlus ® (Thermo Fisher Scientific, Waltham, MA, США).Концентрацию ДНК доводили до 100 нг. Все реакции проводили в трех экземплярах со следующим термическим профилем: 1 цикл при 50 ° C (2 мин), 1 цикл при 95 ° C (10 мин), 40 циклов при 95 ° C (15 с) и 60 ° C ( 30 с). Температуру повышали на 0,3 ° C каждые 10 с с 63 до 95 ° C для получения температуры плавления. Для количественной оценки бактериального титра образцов были построены стандартные кривые для каждого протестированного вида бактерий, построив график значений порога цикла (Ct) в зависимости от титра бактериальных клеток, как измерено путем посева 10-кратных разведений того же образца на среду LB-агар (Lyons et al. al., 2000). При проверке методом взлома генома среднее количество копий детекторного гена на геном было принято равным 1,0 для каждого вида.

Мета-анализ бактериальной ассоциации

Корреляция между природными эпифитными популяциями Psa и других бактерий ( P. syringae pv. syringae, P. viridiflava, P. fluorescens, Pantoea agglomerans / vagans и Lactobacillus spp.) Была оценена на основе данные, полученные в период с 2012 по 2016 год, относящиеся к A.Deliciosa cv. Пробы Хейворда собраны в том же районе и в тот же сезон, что и пробы для метагеномного анализа. Каждый образец промывали по отдельности в 10 мл 10 мМ стерильного раствора MgSO 4 . Количественное определение бактерий выполняли в промывке с помощью кПЦР, как описано выше.

Статистический анализ

Чтобы оценить охват глубины секвенирования, для каждого образца был проведен индивидуальный анализ разрежения с использованием функции «разнообразия» в PAST 3.0 (Hammer et al., 2001). Индексы альфа-разнообразия (Pielou, Inverse Simpson и Shannon) были проанализированы после нормализации с использованием Mothur. Анализ процентов сходства (SIMPER) с использованием метода PAST использовался для расчета среднего несходства и определения идентичности и относительной численности бактериальных таксонов, которые внесли наибольший вклад в наблюдаемые попарные вариации в составе бактериального сообщества из-за различных видов киви (здоровые растения). ), органов (здоровые растения) и патологического статуса (здоровые vs.больные растения). Анализ главных компонентов (PCA) на основе корреляционной матрицы был проведен в PAST для отображения кластеризации образцов в соответствии с дисперсией в популяционном анализе qPCR.

Множественная регрессия была проведена на бактериальных популяциях, чтобы проверить их связь с Psa, используя Statistica ver. 7.0 (Statsoft, Inc., Талса, Оклахома-сити, США). Анализ был ограничен образцами, положительными по Psa, и данные были преобразованы в Log 10 перед обработкой.Статистическая значимость была принята для P <0,05.

Результаты

Описание эпифитного бактериального микробиома киви

В этом исследовании была проанализирована микробиота, связанная с листьями и цветками двух видов киви: A. deliciosa и A. chinensis . После этапа нормализации при 6886 последовательностях на образец в общей сложности было извлечено 1050 бактериальных OTU. Кривые разрежения были близки к насыщению, предполагая, что OTU, восстановленные в этом исследовании, почти представляли все генетическое разнообразие бактерий (дополнительный рисунок S1).OTU были отнесены к 16 типам и 220 различным родам (дополнительная таблица S1). Proteobacteria были наиболее распространенным филумом, представляющим около 77,4% от общего числа контигов, за ним следовали Firmicutes (10,7%), Actinobacteria (6,1%) и Bacteroidetes (3,5%) (рис. На уровне OTU самые распространенные OTU были идентифицированы как Pseudomonas OTU 00001 (31,5%), два неклассифицированных рода из семейства Enterobacteriaceae , OTU 00002 и OTU 00004, что вместе составляет около 15.3% от общего числа последовательностей, Sphingomonas OTU 00003 (5,8%) и Massilia OTU 00005 (4,9%). Первые 10 наиболее распространенных OTU составляли примерно 70% от общего числа последовательностей (Рисунок 1 и дополнительная таблица S1).

РИСУНОК 1. Состав бактериального сообщества на уровне (A) и уровне рода (B) . На столбчатой ​​диаграмме представлены наиболее многочисленные типы и роды. В примерах кода Ac, Actinidia chinensis var.HORT16A; Объявление, Actinidia deliciosa var. Хейворд; D, больной; H, здоровый; F, цветок; L, лист.

Видовая специфичность эпифитного бактериального микробиома

Бактериальное сообщество сформировано видами растений киви (рис. 2). Фактически, общее среднее различие между листьями или цветками двух видов составило 78,27 и 63,26% соответственно. В листьях два неклассифицированных рода (OTU 00004 и 00011), принадлежащих к Enterobacteriaceae , составили около 23% различий.Род Pseudomonas (OTU 00001) также составлял примерно 20% несходства, будучи в 13 раз более распространенным на листьях A. deliciosa , чем на листьях A. chinensis .

РИСУНОК 2. Общее среднее различие между одними и теми же органами, листьями и цветками двух видов киви, A. chinensis и A. deliciosa . Для каждого органа количество OTU, специфичных для одного из двух видов или присутствующих в обоих из них, указано на диаграммах Венна.Показаны десять первых OTU, которые вносят наибольший вклад в общую несходство средних значений и их относительную численность. Цветовая шкала показывает ранжирование относительной OTU: самый высокий (красный), средний балл с 50% процентилем (желтый), самый низкий (зеленый).

На цветках Enterobacteriaceae (OTU 00002) составляли примерно 27% несходства, за которым следует род Sphingomonas (8,4%, OTU 00003). На роды Arthrobacter (OTU 00013) и Bacillus (OTU 00009) приходилось 5 и 4% различий соответственно.На Pseudomonas (OTU 00001) приходилось только 2,7% несходства.

Влияние видов растений киви было подтверждено также тремя определенными индексами биоразнообразия: Shannon ( H ′), Inverse Simpson (1/ D ′) и Pielou ( J ′). Более высокое биоразнообразие наблюдалось у листьев A. chinensis ( H ′ = 4,02; 1/ D ′ = 11,93; J ′ = 0,65), чем у листьев A. deliciosa ( H ′ = 2.99; 1/ D ′ = 7,16; J ′ = 0,54). Аналогичным образом, более высокие значения всех рассмотренных индексов были обнаружены для A. chinensis ( H ′ = 4,13; 1/ D ′ = 30,14; J ′ = 0,70), чем для A. deliciosa ( H ′ = 2,76; 1/ D ′ = 5,73; J ′ = 0,49) цветов (таблица 2).

ТАБЛИЦА 2. Резюме оценки разнообразия для каждой выборки.

Органоспецифический эпифитный бактериальный микробиом

У каждого вида киви цветы и листья содержат особый бактериальный микробиом.Фактически, у A. chinensis общее среднее различие между листьями и цветками составляло 71,16%, а для A. deliciosa — 58,55% (рис. 3). В A. chinensis неклассифицированный род (OTU 00004), принадлежащий к Enterobacteriaceae , составлял 16,48% несходства, за которым следует род Bacillus (OTU 00009, 5,13%). С другой стороны, в A. deliciosa OTU 00002, принадлежащий к Enterobacteriaceae , приходилось около 29% несходства, будучи в 13 раз более распространенным на цветках, в то время как род Pseudomonas (OTU 00001) составлял примерно 19% несходство, и его было больше на листьях, чем на цветках (рис. 3).

РИСУНОК 3. Общее среднее различие между листьями и цветками одного и того же вида киви, A. chinensis или A. deliciosa . Для каждого вида количество OTU, специфичных для одного из двух органов или присутствующих в обоих из них, указано на диаграммах Венна. Показаны десять первых OTU, которые вносят наибольший вклад в общую несходство средних значений и их относительную численность. Цветовая шкала показывает ранжирование относительной OTU: самый высокий (красный), средний балл с 50% процентилем (желтый), самый низкий (зеленый).

Эти данные согласуются с трендом индексов биоверсности. В A. chinensis было более биоразнообразное сообщество эпифитных бактерий ( H ′ = 4,13; 1/ D ′ = 30,14; J ′ = 0,70), чем на листьях ( H ′ = 4,02; 1/ D ′ = 11,93; J ′ = 0,65). С другой стороны, у A. deliciosa бактериальное сообщество было более сложным в листьях ( H ′ = 2,99; 1/ D ′ = 7,16; J ′ = 0.54), чем цветы ( H ′ = 2,76; 1/ D ′ = 5,73; J ′ = 0,49) (таблица 2).

Влияние инфекции Psa на эпифитный бактериальный микробиом

Подробное сравнение изменений бактериального сообщества, связанных с инфекцией Psa, показало, что общее среднее различие между листьями и цветками здоровых и инфицированных растений колебалось от 79,10 до 66,70% у A. chinensis и от 64,45 до 35,41% у A. deliciosa (Рисунки 4A, B).

РИСУНОК 4. Общее среднее различие между листьями и цветками здоровых и инфицированных A. chinensis растений (A) и A. deliciosa (B) (H, здоровые; D, больные, инфицированные Pseudomonas syringae pv. actinidiae ). Для каждой комбинации видов и органов количество OTU, специфичных для образцов H или D или присутствующих в них обоих, указано на диаграммах Венна. Показаны десять первых OTU, которые вносят наибольший вклад в общую несходство средних значений и их относительную численность.Цветовая шкала показывает ранжирование относительной OTU: самый высокий (красный), средний балл с 50% процентилем (желтый), самый низкий (зеленый).

В A. chinensis существенное увеличение численности рода Pseudomonas (OTU 00001) в инфицированных листьях и цветках составило 8,25 и 47,86%, соответственно (рис. 4A). Аналогичный результат наблюдался для A. deliciosa , когда у рода Pseudomonas (OTU 00001) увеличивалось до трех и двух раз в листьях и цветках, соответственно (рис. 4B).

Снижение разнообразия бактериального сообщества наблюдалось после заражения Psa, за исключением цветков A. deliciosa , о чем свидетельствуют индексы биоразнообразия (Таблица 2). Инфекция Psa вызвала заметное снижение равномерности популяции и биоразнообразия у инфицированных A. chinensis (цветы и листья) и A. deliciosa (только листья) с доминированием нескольких родов, в основном Pseudomonas (OTU 00001).

Диаграммы Венна на рисунке 5 описывают распределение уникальных и общих OTU у здоровых и больных растений в двух проанализированных видах и тканях.Инфекция Psa оказала сильнейшее влияние на бактериальное сообщество листьев A. deliciosa по сравнению с другими проанализированными условиями: только 37 OTU были разделены между здоровыми и больными листьями. Кроме того, на инфицированных листьях A. deliciosa мы идентифицировали некоторые специфические OTU, принадлежащие Oxalobacteraceae (OTU 00043, OTU 00186), Haemophilus (OTU 00076), Moraxellaceae (OTU 00323), которые не присутствовали у здоровых животных. A. deliciosa листьев (Дополнительная таблица S1).Наконец, значительное количество OTU с высокой численностью исчезло или показало резкое сокращение на листьях инфицированных растений (дополнительная таблица S1). Аналогичная тенденция наблюдалась для цветков и листьев A. chinensis . Также в этом случае здоровые растения характеризовались наличием характерных ОТЕ, отсутствующих у больных (например, Epilithonimonas OTU 00016, Porphyromonas OTU 00110, Bacteroides OTU 00111).

РИСУНОК 5. Диаграммы Венна, показывающие уникальные и общие ОТЕ между здоровой и больной тканями. (A) A. chinensis Больные и здоровые листья и цветы. (B) A. deliciosa Больные и здоровые листья и цветы.

С другой стороны, в цветках A. deliciosa некоторые OTU были более многочисленны или присутствовали только в образцах больных (например, Pseudomonas OTU 00001, Propionibacterium OTU 00012, Weissella OTU 00029) (дополнительная таблица S1) .

Численность и динамика

Pseudomonas spp. Патогены и предполагаемые бактериальные агенты биоконтроля в связи с патологическим статусом растений

Количественная ПЦР применялась для определения наличия в отношении патологического статуса растений двух других патогенных бактерий киви: P. syringae pv. syringae (Pss) и P. viridiflava (Pv) и виды бактерий с потенциальной биоконтролирующей активностью, такие как P. agglomerans / vagans, L.plantarum, B. subtilis, B. amyloliquefaciens и P. fluorescens (Choudhary, Johri, 2009; Savitha et al., 2013; Bonaterra et al., 2014; Dutkiewicz et al., 2016; Sharifazizi et al., 2017). Новые наборы праймеров были разработаны для L. plantarum и Psa. Анализ кривых плавления (дополнительный рисунок S1) выявил специфичность сконструированных праймеров: наблюдался уникальный пик, свидетельствующий о специфичности амплификации, то есть каждая пара праймеров амплифицировала уникальный локус, нацеленный на геном.

У растений, инфицированных Psa, присутствовали все три патогена, хотя популяции Pss и Pv в целом были ниже, чем Psa (рис. 6). Psa и Pss / Pv были связаны в 62,5% цветков. В незараженных образцах патогены не были обнаружены, за исключением небольшого количества Pss на листьях A. chinensis (рис. 6). Анализ PCA показал, что здоровые растения сгруппированы вместе. В частности, больные цветки обоих видов в основном характеризовались присутствием Pv, в то время как Psa и Pss в основном ассоциировались с больными листьями (рис. 7).Значительная корреляция была обнаружена между эпифитными популяциями Psa и Pss / Pv для значений ниже 10 9 бактериальных клеток на цветок (Фигуры 7B, C).

РИСУНОК 6. Численность в каждом образце (среднее ± стандартная ошибка, n = 5) Pseudomonas syringae pv. actinidiae (Psa), Pseudomonas syringae pv. syringae (Pss) и Pseudomonas viridiflava (Pv), определенные с помощью количественной ПЦР.

РИСУНОК 7. Ассоциация Pseudomonas syringae pv. actinidiae (Psa) с P. syringae pv. syringae (Pss) и P. viridiflava (Pv). (A) Распределение PCA (с функцией биплот), показывающее распределение образцов от здоровых и инфицированных растений на основе количественной оценки патогенов с помощью qPCR. (B) Линейная регрессия между популяциями Psa и Pss. (C) Линейная регрессия между популяциями Psa и Pv в инфицированных цветках.В (B, C) наборы данных были ограничены образцами, представляющими популяцию Psa ниже 10 9 бактериальных клеток цветок -1 .

Что касается видов бактерий с потенциальной биологической активностью ( P. agglomerans / vagans, L. plantarum, B. subtilis, B. amyloliquefaciens и P. fluorescens ), все они были обнаружены в образцах здоровых растений, в то время как только L. plantarum появились также в соответствующих инфицированных органах, а P.fluorescens присутствовал в пораженных листьях, но не в цветках (рис. 8). B. amyloliquefaciens обнаружен в некоторых образцах больных без связи с видом или органом растения. Остальные виды не присутствовали в образцах больных. P. agglomerans / vagans и P. fluorescens размеры популяции были обратно коррелированы с Psa для популяций патогенов ниже 10 5 и 10 6 бактериальных клеток на грамм ткани соответственно.Не было обнаружено значимой корреляции с Lactobacillus spp. Анализ главных компонентов показал, что больные растения хорошо дифференцировались от здоровых и что присутствие L. plantarum и P. agglomerans / vagans было в основном отличительным от A. chinensis и A. deliciosa соответственно (рис. 9).

РИСУНОК 8. Численность (среднее ± стандартная ошибка, n = 5) L. plantarum, P.aglomerans, B. subtilis, B. amyloliquefaciens и P. fluorescens , определенный методом количественной ПЦР.

РИСУНОК 9. Ассоциация Pseudomonas syringae pv. actinidiae (Psa) с Pantoea agglomerans / vagans, P. fluorescens, Lactobacillus plantarum и Bacillus spp. (A) Распределение PCA (с функцией двух графиков), показывающее распределение образцов от здоровых и инфицированных растений на основе количественного определения BCA. (B) Линейная регрессия между популяциями Psa и Pantoea agglomerans / vagans . (C) Линейная регрессия между популяциями Psa и P. fluorescens . (D) Диаграмма рассеяния, представляющая Psa и Lactobacillus spp. популяции на образцах листьев. В (B – D) наборы данных были ограничены образцами, представляющими популяцию Psa ниже 10 6 бактериальных клеток g -1 ткани.

Обсуждение

Биоразнообразие микробов в

Актинидии Филлосфера

Филосфера поддерживает сложные микробные популяции, а микробиота филлосферы может способствовать росту растений или проявлять биоконтроль против различных патогенов растений (Thapa et al., 2017). На численность и пространственное распределение микробиоты филлосферы в значительной степени влияют факторы окружающей среды, но генотип растения-хозяина также играет ключевую роль (Bringel and Couée, 2015). Действительно, в предыдущем исследовании ядро ​​сообщества из 31 вида бактерий, что составляет 99,8% от общего числа последовательностей, было обнаружено в образцах пыльцы киви независимо от различного географического происхождения и года сбора (Kim M.J. et al., 2018). Настоящее исследование дает исчерпывающее описание эпифитных бактериальных сообществ на цветках и листьях A . chinensis и A. deliciosa , два основных коммерческих вида киви, и подчеркивает их изменчивость в отношении инфекции Psa. Различия в структуре микробиоты исследовали также путем определения трех индексов биоразнообразия. Для экстраполяции общего богатства наблюдаемых OTU использовались индексы Шеннона и Обратного Симпсона. Первый является наиболее широко используемым индексом, основанным на видовом богатстве и чувствительным к изменениям в редких видах, в то время как последний предпочтительнее других показателей альфа-разнообразия, поскольку он учитывает равномерность в дополнение к количеству видов.Наконец, индекс Пиелу предоставляет информацию о равномерности видов в диапазоне от 0 до 1, где 1 представляет идеальную ровность, а 0 — полное доминирование. В филлосфере киви наиболее многочисленными типами были Proteobacteria, Firmicutes, Actinobacteria и Bacteroidetes . Эти типы считаются ассоциированными с филлосферой универсалистами, и было обнаружено, что они являются наиболее многочисленными типами в филлосфере нескольких видов растений (Bulgarelli et al., 2013; Bringel and Couée, 2015; Kim M.J. et al., 2018). Наиболее часто встречались роды Pseudomonas , Sphingomonas и Massilia . Об их присутствии также сообщали другие авторы в других растениях-хозяевах (López-Velasco et al., 2011; Bodenhause et al., 2013; Bogas et al., 2015). Преобладающий род — Pseudomonas . В целом псевдомонады колонизируют поверхности растений, и многие штаммы обладают интересным потенциалом для биоконтроля (Thapa et al., 2017). Некоторые виды, такие как P. putida , известны своей способностью растворять фосфат и продуцировать ИУК (Adesemoye et al., 2008; Голами и др., 2009; Ахемад и Хан, 2012; Ахемад и Кибрет, 2014). Штаммы P. fluorescens, P. aeruginosa, P. asplenii и P. protegens также используются в качестве средств биоконтроля против различных патогенов (Krishnamurthy and Gnanamanickam, 1998; Akter et al., 2016; Michavila et al., 2017).

Класс Actinobacteria также представляет собой резервуар потенциальных BCA. Члены этого типа хорошо известны своей способностью продуцировать вторичные метаболиты с применением в сельскохозяйственной, фармацевтической и медицинской промышленности (Himaman et al., 2016). В нескольких исследованиях предлагалось использовать их в качестве BCA (El-Tarabily et al., 2000; Kunoh, 2002; Cao et al., 2005; Prapagdee et al., 2008; Mingma et al., 2014). Они играют ключевую роль в качестве стимуляторов роста растений, индукторов устойчивости к болезням и стимуляторов засухоустойчивости (Himaman et al., 2016).

Род Sphingomonas обычно действует как род, защищающий растения, подавляя симптомы болезни и уменьшая рост патогенов (Kim D. et al., 2018). Innerebner et al. (2011) показали, что инокуляция штаммом Sphingomonas sp.штамм уменьшил численность патогенов растений Pseudomonas syringae pv. помидор DC3000 и Xanthomonas campestris pv. campestris LMG 568 на листьях Arabidopsis . Род Massilia принадлежит к семейству Oxalobacteraceae . Присутствие Massilia spp. был обнаружен в филлосфере различных растений, в том числе салата и яблони (Bassas-Galia et al., 2012; Rastogi et al., 2012; Yashiro, McManus, 2012).

Бактериальные сообщества, специфичные для хозяина

Как на цветках, так и на листьях, эпифитное бактериальное сообщество различается в зависимости от вида киви. Основными таксонами, способствовавшими различиям, были Enterobacteriaceae, Pseudomonas, Acinetobacter и Sphingomonadaceae на листьях и Sphingomonas, Arthrobacter, Bacillus и Bradyrhizobiaceae на цветках. Об обнаружении этого последнего рода сообщалось также в филлосфере шпината, риса и табака, что свидетельствует о вертикальной передаче бактерий из семян в филлосферу (Chi et al., 2005; Ли и др., 2010; Лопес-Веласко и др., 2013).

Полученные здесь данные согласуются с другими исследованиями, показывающими, что разные генотипы растений одного и того же вида могут содержать разные бактериальные сообщества (De Costa et al., 2006; Vorholt, 2012). Наблюдаемые различия могут быть связаны с анатомическими различиями листьев и цветов двух видов киви. Фактически, бактерии неравномерно распределены по поверхности листа: вместо этого они образуют разбросанные микроколонии вблизи трихом, устьиц, соединений стенок эпидермальных клеток и бороздок вдоль жилок (Lindow, Brandl, 2003; Vorholt, 2012), где находятся вода и питательные вещества. наиболее доступны (Kinkel, 1997; Leveau, Lindow, 2001; Monier, Lindow, 2004; Vorholt, 2012).Одно из наиболее значительных анатомических различий между A. deliciosa и A. chinensis связано со структурой и плотностью трихома. У сорта A. chinensis в листьях наблюдается более высокая плотность трихомов по сравнению с сортами A. deliciosa (He et al., 2000; Spinelli et al., 2011). Более того, трихомы у A. chinensis характеризуются более высоким центральным стеблем (He et al., 2000). Эти различия в численности трихомов могут влиять на состав и структуру микробного сообщества.

Органоспецифические бактериальные сообщества

Различия в микробном сообществе наблюдались также в разных органах одного и того же вида растений. Листья A. chinensis были заселены в основном Enterobacteriaceae и Pseudomonas , тогда как на цветках наиболее многочисленными родами были Pseudomonas и Bacillus , и наблюдалось более высокое общее биоразнообразие. Напротив, в A. deliciosa влияние органов на микробный состав было менее очевидным, чем в A.chinensis , поскольку Pseudomonas и Enterobacteriaceae были доминирующими группами как на листьях, так и на цветках. Орган-специфические патогенные консорциумы наблюдались у хозяина, инфицированного Psa. Фактически, Pss, который в первую очередь вызывает симптомы пятнистости листьев (Petriccione et al., 2017), в большей степени обнаруживается на листьях, инфицированных Psa, в то время как Pv, ответственный за бактериальный ожог (Balestra et al., 2008), более тесно связан. к цветкам, инфицированным Psa.

Так как цветы состоят из разных тканей (рыльца, стигмы, пыльники, яичники, нектароды), каждый из них обеспечивает благоприятную и уникальную среду для местного микробного сообщества (Howpage et al., 1998; Спинелли и др., 2005; Aleklett et al., 2014), можно было ожидать более высокого биоразнообразия на цветках, чем на листьях. Однако некоторые части цветка могут быть менее восприимчивы к бактериальным эпифитам, чем листья. Фактически, Junker et al. (2011) наблюдали более низкое биоразнообразие на лепестках, чем на листьях лотоса Lotus corniculatus и Saponaria officinalis . С этой точки зрения относительная организация, пропорции и химические особенности Actinidia spp. части цветка могут быть вызваны для объяснения различий в бактериальной колонизации.Несмотря на одинаковую базовую структуру, цветки A. chinensis и A. deliciosa также демонстрируют очевидные морфологические различия. Цветки A. deliciosa имеют большее количество стилей и тычинок, а околоцветник и андроеций ближе к гинецею, в результате чего чаша для нектара более защищена, чем в цветке A . chinensis (Harvey, Fraser, 1988; Huang, 2014). Вполне вероятно, что это последнее свидетельство могло стать препятствием для формирования очень разнообразного сообщества, как это наблюдалось на A.Deliciosa цветков по сравнению с листьями. Более того, производство летучих соединений может в дальнейшем действовать как селективный агент на эпифитную микрофлору (Junker et al., 2011). Например, было обнаружено, что сесквитерпен α-фарнезен играет роль в защите растений (Huelin and Murray, 1966; Pare and Tumlinson, 1999; Yang et al., 2011), выступая в качестве сдерживающего фактора питания насекомых (Aharoni et al. ., 2003) и проявляют токсичность для бактерий (Chorianopoulos et al., 2004) и грибов (Terzi et al., 2007).Это соединение является основным компонентом цветочного букета запаха A . deliciosa , а A. chinensis не выделяет или почти не выделяет (Тацука и др., 1990; Crowhurst et al., 2008; Nieuwenhuizen et al., 2009; Green et al., 2012).

Антагонистические и синергические отношения Psa с другими микробами

Pseudomonas syringae pv. Инфекция actinidiae оказала несколько эффектов на разнообразие и таксономическую структуру бактериальных сообществ, за исключением A.Deliciosa цветов. Механизм, с помощью которого Psa противодействует местным бактериям, определяя его доминирование на листьях A. chinensis и A. deliciosa и исчезновение большинства доминирующих видов микробов, вероятно, основан на конкуренции за ограничение питательных ресурсов, поскольку механизм основан на на antibiosis не будут затронуты растением-хозяином. С этой точки зрения специализированный патоген, такой как Psa, должен быть в состоянии вытеснить в филлосфере Actinidia других неспециализированных резидентов.Обширный скрининг растительного материала, собранного из зараженных садов в течение 4 лет, подтвердил отрицательную корреляцию между популяциями Psa и P. agglomerans / vagans или P. fluorescens , когда популяция этих двух бактерий колеблется между 10 4 и 10 6 . Таким образом, даже несмотря на то, что в сильно инфицированных листьях Psa подавляет других бактериальных конкурентов, на ранних стадиях эпифитного роста Psa конкурирует с P. aglomerans / vagans или P.fluorescens может препятствовать достижению порога инфицирования (примерно 10 5 клеток Psa на грамм ткани) (Donati et al., 2018). С другой стороны, не наблюдалось никакого антагонизма между Psa и Lactobacillus spp. , что позволяет предположить, что бактерии последней группы слабо подвержены влиянию Psa-конкуренции. По сравнению с листьями или цветками A. chinensis , Psa проявляет слабый антагонизм по отношению к другим обитателям цветков A. deliciosa (Рисунок 1B и Таблица 2).Таким образом, можно сделать вывод, что эта ниша не очень благоприятна для Psa или что другие бактерии так же специализированы и адаптированы к цветочной нише, как Psa. Это наблюдение, вместе с более высокой относительной численностью Psa на цветках A. chinensis , также может способствовать объяснению более высокой восприимчивости этих цветков по сравнению с цветками A. deliciosa (Donati et al., 2018), несмотря на то, что аналогичных размеров популяции Psa, которые могут быть достигнуты у двух видов (рис. 6).

Количественный анализ полимеразной цепной реакции в реальном времени показал, что Psa формирует синдемическую ассоциацию с Pss и Pv. Фактически, цветы, инфицированные Psa, также содержат обнаруживаемые популяции Pss и Pv в 62,5% случаев. Разумно предположить, что эти три вида образуют консорциум, который может более эффективно конкурировать в эпифитной нише (Buonaurio et al., 2015). Было показано, что при наличии ассоциации Psa и Pss более эффективно заражают растение-хозяин (Petriccione et al., 2017). Такие наблюдения представляют интересное значение для борьбы с бактериальным раком киви. Например, лечение, направленное на сокращение популяции Pss и / или Pv, может быть предусмотрено для ограничения патогенности Psa. Кроме того, взлом сигнальной сети между различными видами патогенов может быть стратегией подавления их вирулентности в полевых условиях. Сообщалось, что многие грамм-отрицательные патогены ассоциированных с растениями бактерий регулируют свою вирулентность с помощью N -ацил-гомосериновых лактонов (AHL) (Ma et al., 2013). Модель восприятия кворума AHL включает синтазу AHL, которая принадлежит к семейству белков LuxI, и рецепторы / регуляторы транскрипции AHL (LuxR) (Papenfort and Bassler, 2016). Psa не производит AHL, и полная система LuxI / R отсутствует. Тем не менее, у него есть три предполагаемых соло LuxR (Patel et al., 2014). Два из них отвечают на экзогенные AHL, тогда как третий, скорее всего, участвует в передаче сигналов между царством (Patel et al., 2014). Наличие трех соло LuxR довольно необычно, поскольку чаще всего протеобактерии обладают только одним, поэтому они могут представлять эволюционное преимущество для Psa, способствующее общению с другими эпифитными бактериями (Patel et al., 2014).

Наконец, внутри этого бактериального консорциума может быть облегчен горизонтальный перенос генов, что позволяет быстрее адаптироваться к изменениям окружающей среды и стрессам. Фактически, дополнительный геном комплекса P. syringae характеризуется геномными островками и различными мобильными элементами, такими как инсерционные последовательности (IS-элементы), транспозоны, плазмиды и интегративные конъюгативные элементы (ICE) (Butler et al., 2013). ). Эти мобильные элементы включают гены, связанные с экологической пригодностью и вирулентностью, такими как выработка токсинов (Murillo et al., 2011), медь и устойчивость к антибиотикам (Butler et al., 2013; Colombi et al., 2017), образование сидерофоров и деградация фенольных соединений (Scortichini et al., 2012). В этом смысле возможность охарактеризовать «филлобиом» посредством применения высокопроизводительных технологий секвенирования следующего поколения позволяет стратегически выбирать BCA, высокоспециализированные для наиболее чувствительных путей заражения хозяина. Среди предполагаемых BCA, изученных в этой работе, например, только L. plantarum колонизировали как инфицированные, так и здоровые цветы и листья двух видов Actinidia , а B.amyloliquefaciens иногда может быть обнаружен в инфицированных тканях, хотя и независимо от органа или вида растения. Кроме того, объединение дополнительной информации, полученной с помощью технологий секвенирования следующего поколения и метанализа ассоциации популяций, позволило идентифицировать других кандидатов в BCA, таких как P. agglomerans / vagans или P. fluorescens. Способность испытанных BCA сохраняться в этих органах, несмотря на инфекцию Psa, может быть связана со способностью представителей этого вида оказывать сильный антагонистический эффект против других микробов, населяющих ту же нишу, путем высвобождения широкого спектра антибиотиков. -микробные соединения, открывающие новые возможности для использования в качестве BCA.

Заключение

Данные, полученные в этой работе, впервые выявили влияние Psa на бактериальные сообщества, связанные с растениями киви. Представленные здесь результаты дают новое представление о том, как Psa влияет на микробные сообщества, связанные с листом и цветком киви. Сложные взаимодействия между хозяином, окружающей средой и микробами играют роль в определении исхода инфекционного процесса и в определении ниш, важных для резидентных бактерий.Основные причины, лежащие в основе этих изменений, остаются неясными, и для лучшего понимания этого процесса потребуются большие междисциплинарные усилия, а также комплексный подход к обнаружению триггеров вспышки болезни у киви, чтобы разработать более устойчивые стратегии борьбы с бактериальной инфекцией. язвенная болезнь киви.

Авторские взносы

FS задумал эксперимент и руководил работой. ID внесла свой вклад в разработку экспериментов и выполнила отбор всех образцов, а также классический микробиологический и патологический анализ.AC и ID выполнили экстракцию ДНК, количественную ПЦР и идентификацию бактерий. LO, AL и WP проанализировали данные секвенирования следующего поколения. FS, LO, ID и GP составили рукопись. Все авторы критически внесли свой вклад в обзор рукописи и обсуждение данных.

Финансирование

Работа финансировалась Седьмой рамочной программой Европейского Союза по исследованиям, технологическим разработкам и демонстрациям в соответствии с соглашением о гранте №. 613678 (Dropsa — Стратегии разработки эффективных, инновационных и практических подходов к защите основных европейских плодовых культур от вредителей и патогенов).

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

Благодарности

Мы благодарим доктора Симону Нардоццу и команду фотографов из Plant & Food Research, Новая Зеландия, за фотографии цветов и листьев Actinidia deliciosa и Actinidia chinensis .

Дополнительные материалы

Дополнительные материалы к этой статье можно найти в Интернете по адресу: https: // www.frontiersin.org/articles/10.3389/fpls.2018.01563/full#supplementary-material

Сноски

  1. http://www.ncbi.nlm.nih.gov
  2. http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi/
  3. http://www.ebi.ac.uk/blastall/nucleotide.html

Список литературы

Adesemoye, A.O., Obini, M., and Ugoji, E.O. (2008). Сравнение стимуляции роста растений Pseudomonas aeruginosa и Bacillus subtilis в трех овощах. Braz. J. Microbiol. 39, 423–426. DOI: 10.1590 / S1517-83822008000300003

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Aharoni, A., Giri, A. P., Deuerlein, S., Griepink, F., de Kogel, W.-J., Verstappen, F. W. A., et al. (2003). Метаболизм терпеноидов у диких и трансгенных растений Arabidopsis. Растительная клетка 15, 2866–2884. DOI: 10.1105 / tpc.016253

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ахемад, М., и Хан, М.С. (2012). Оценка стимулирующей рост растений активности ризобактерий Pseudomonas putida при гербицидном стрессе. Ann. Microbiol. 62, 1531–1540. DOI: 10.1007 / s13213-011-0407-2

CrossRef Полный текст | Google Scholar

Ахемад, М., Кибрет, М. (2014). Механизмы и применения ризобактерий, способствующих росту растений: текущая перспектива. J. King Saud Univ. Sci. 26, 1–20. DOI: 10.1016 / j.jksus.2013.05.001

CrossRef Полный текст | Google Scholar

Актер, С., Кадир, Дж., Джураими, А. С., и Сауд, Х. М. (2016). Оценка in vitro бактериальных изолятов Pseudomonas из филлопланы риса для биоконтроля Rhizoctonia solani и признаков, способствующих росту растений. J. Environ. Биол. 37, 597–602.

PubMed Аннотация | Google Scholar

Алеклетт, К., Харт, М., и Шейд, А. (2014). Микробная экология цветов: новый рубеж в исследованиях филлосферы. Ботаника 92, 253–266.

Google Scholar

Алими, М., Рахимиан, Х., Хасанзаде, Н., Дарзи, М. Т., Ахмадиха, А., Хейдари, А., и Балестра, Г. М. (2011). Первое обнаружение Pseudomonas viridiflava, возбудителя бактериального ожога яблони, с помощью специально разработанных праймеров. Afr. J. Microbiol. Res. 5, 4708–4713. DOI: 10.5897 / AJMR11.840

CrossRef Полный текст | Google Scholar

Балестра, Г. М., Маццалья, А., и Россетти, А. (2008). Вспышка бактериального ожога цветка, вызванного Pseudomonas viridiflava на Actinidia chinensis киви в Италии. Завод Dis. 92: 1707. DOI: 10.1094 / PDIS-92-12-1707A

CrossRef Полный текст | Google Scholar

Бассас-Галия, М., Ногалес, Б., Ариас, С., Роде, М., Тиммис, К. Н., и Молинари, Г. (2012). Посадите исходные изоляты Massilia , производящие полигидроксибутират, в том числе один, показывающий высокие выходы из глицерина. J. Appl. Microbiol. 112, 443–454. DOI: 10.1111 / j.1365-2672.2011.05228.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Берг, Г., Grube, M., Schloter, M., and Smalla, K. (2014). Микробиом растений и его значение для здоровья растений и человека. Фронт. Microbiol. 5: 491. DOI: 10.3389 / fmicb.2014.00491

CrossRef Полный текст | Google Scholar

Боденхауз, Н., Хортон, М. В., и Бергельсон, Дж. (2013). Бактериальные сообщества, связанные с листьями и корнями Arabidopsis thaliana . PLoS One 8: e56329. DOI: 10.1371 / journal.pone.0056329

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Богас, А., Феррейра, А. Дж., Луис Араужу, В., Астолфи-Филью, С., Китадзима, Э. У., Лакава, П. Т. и др. (2015). Эндофитное бактериальное разнообразие в филлосфере Амазонки Paullinia cupana связано с бессимптомным и симптоматическим антракнозом. Springerplus 4: 258. DOI: 10.1186 / s40064-015-1037-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Bonaterra, A., Cabrefiga, J., Mora, I., Roselló, G., Francés, J., and Montesinos, E. (2014). Грамположительные бактерии, продуцирующие антимикробные пептиды, как эффективные средства биоконтроля бактериального ожога. Acta Hortic. 1056, 117–122. DOI: 10.17660 / ActaHortic.2014.1056.16

CrossRef Полный текст | Google Scholar

Браун-Кевник А., Леманн А., Реццонико Ф., Венд К., Смитс Т. Х. и Даффи Б. (2012). Разработка количественных ПЦР-анализов, специфичных для видов, штаммов и биосинтеза антибиотиков для Pantoea agglomerans в качестве инструментов для мониторинга биоконтроля. J. Microbiol. Методы 90, 315–320. DOI: 10.1016 / j.mimet.2012.06.004

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Брингель, Ф., и Couée, I. (2015). Основные роли микроорганизмов филлосферы на стыке между функционированием растений и динамикой газовых примесей в атмосфере. Фронт. Microbiol. 6: 486. DOI: 10.3389 / fmicb.2015.00486

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Bulgarelli, D., Schlaeppi, K., Spaepen, S., van Themaat, E. V. L., and SchulzeLefert, P. (2013). Структура и функции бактериальной микробиоты растений. Annu. Rev. Plant Biol. 64, 807–838.DOI: 10.1146 / annurev-arplant-050312-120106

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Буонаурио, Р., Моретти, К., да Силва, Д. П., Кортезе, К., Рамос, К., и Вентури, В. (2015). Болезнь оливкового узла как модель для изучения роли межвидовых бактериальных сообществ в болезнях растений. Фронт. Растение. Sci. 6: 434. DOI: 10.3389 / fpls.2015.00434

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Басби, П. Э., Соман, К., Wagner, M. R., Friesen, M. L., Kremer, J., Bennett, A., et al. (2017). Приоритеты исследований для использования микробиомов растений в устойчивом сельском хозяйстве. PLoS Biol. 15: e2001793. DOI: 10.1371 / journal.pbio.2001793

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Батлер М. И., Стоквелл П. А., Блэк М. А., Дэй Р. К., Ламонт И. Л. и Поултер Р. Т. М. (2013). Pseudomonas syringae pv. actinidiae из недавних вспышек бактериального рака киви принадлежат к разным клонам, возникшим в Китае. PLoS One 8: e57464. DOI: 10.1371 / journal.pone.0057464

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Цао, Л. X., Цю, З. К., Ю, Дж. Л., Тан, Х. М., и Чжоу, С. (2005). Выделение и характеристика эндофитных антагонистов стрептомицетов возбудителя фузариозного увядания из корней банана, стерилизованных на поверхности. FEMS Microbiol. Lett. 247, 147–152. DOI: 10.1016 / j.femsle.2005.05.006

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Чи, Ф., Шен, С., Ченг, Х., Цзин, Ю., Янни, Ю. Г., и Даззо, Ф. Б. (2005). Восходящая миграция эндофитных ризобий от корней к листьям внутри рисовых растений и оценка преимуществ для физиологии роста риса. Заявл. Environ. Microbiol. 71, 7271–7278. DOI: 10.1128 / AEM.71.11.7271-7278.2005

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Чорианопулос, Н., Калпуцакис, Э., Алигианнис, Н., Митаку, С., Найчас, Г.-Дж., и Арутюнян, С.А. (2004). Эфирные масла видов Satureja, Origanum и Thymus : химический состав и антибактериальная активность в отношении патогенов пищевого происхождения. J. Agric. Food Chem. 52, 8261–8267. DOI: 10.1021 / jf049113i

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Чоудхари, Д. К., Джохри, Б. Н. (2009). Взаимодействия Bacillus spp. и растения. Особое внимание уделяется индуцированной системной устойчивости (ISR) Microbiol. Res. 164, 493–513. DOI: 10.1016 / j.micres.2008.08.007

PubMed Аннотация | CrossRef Полный текст

Коллина, М., Донати, И., Бертаккини, Э., Брунелли А., Спинелли Ф. (2016). Парниковые тесты по контролю бактериального рака киви Pseudomonas syringae pv. актинидии . J. Berry Res. 6, 407–415. DOI: 10.3233 / JBR-160128

CrossRef Полный текст | Google Scholar

Коломби, Э., Штрауб, К., Кюнцель, С., Темплтон, М. Д., Макканн, Х. К., и Рейни, П. Б. (2017). Эволюция устойчивости к меди у возбудителя киви Pseudomonas syringae pv. actinidiae путем приобретения интегративных конъюгативных элементов и плазмид. Environ. Microbiol. 19, 819–832. DOI: 10.1111 / 1462-2920.13662

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Регламент Комиссии [EC] (2008). № 149/2008 от 29 января 2008 г. о внесении поправок в Регламент (ЕС) № 396/2005 Европейского парламента. (и) Совета путем принятия Приложений II, III и IV, устанавливающих максимальные уровни остатков для продуктов, подпадающих под действие Приложения I. Доступно по адресу: http://data.europa.eu/eli/reg/2008/149/oj

Google Scholar

Кроухерст, Р.Н., Глив, А. П., Макрей, Э. А., и Монтефиори, М. (2008). Анализ экспрессируемых тегов последовательностей из Actinidia : применение межвидовой базы данных EST для обнаружения генов в областях вкуса, здоровья, цвета и созревания. BMC Genomics 9: 351. DOI: 10.1186 / 1471-2164-9-351

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Де Коста, Д. М., Ратнаяке, Р. М. П. С., Де Коста, В. А. Дж. М., Кумари, В. М. Д. и Диссанаяке, Д. М. Н. (2006).Вариация микрофлоры филлосферы различных сортов риса в Шри-Ланке и ее связь с анатомическими и физиологическими особенностями листа. J. Agro. Crop Sci. 192, 209–220. DOI: 10.1111 / j.1439-037X.2006.00207.x

CrossRef Полный текст | Google Scholar

Dees, M. W., Lysøe, E., Nordskog, B., and Brurberg, M. B. (2015). Сообщества бактерий, связанные с поверхностями листовой зелени: изменение состава и уменьшение богатства с течением времени. Заявл. Environ.Microbiol. 81, 1530–1539. DOI: 10.1128 / AEM.03470-14

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Донати И., Буриани Г., Челлини А., Маури С., Коста Г. и Спинелли Ф. (2014). Новые сведения о бактериальном раке киви ( Pseudomonas syringae pv. actinidiae ). J. Berry Res. 4, 53–67. DOI: 10.5423 / PPJ.NT.12.2017.0281

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Донати, И., Челлини, А., Буриани, Г., Маури, С., Кей, К., Таккони, Г. и др. (2018). Пути заражения цветков и опосредованное пыльцой распространение Pseudomonas syringae pv. actinidiae , возбудитель бактериального рака киви. Hortic. Res. 5:56. DOI: 10.1038 / s41438-018-0058-6

CrossRef Полный текст | Google Scholar

Дуткевич Дж., Мацкевич Б., Лемешек М. К., Голе М. и Милановски Дж. (2016). Pantoea agglomerans: загадочная бактерия зла и добра.Часть IV. Благоприятные эффекты. J. Ann. Agric. Environ. Med. 23, 6–29. DOI: 10.5604 / 12321966.1196848

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Эдгар Р. К., Хаас Б. Дж., Клементе Дж. К., Айва К. и Найт Р. (2011). UCHIME улучшает чувствительность и скорость обнаружения химер. Биоинформатика 27, 2194–2200. DOI: 10.1093 / биоинформатика / btr381

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Эль-Тарабилы, К.A., Soliman, H.M., Nassar, A.H., Al-Hassani, H.A., Sivasithamparam, K., McKenna, F., et al. (2000). Биологический контроль Sclerotinia minor с помощью ахитинолитических бактерий и актиномицетов. Plant Pathol. 49, 573–583. DOI: 10.1046 / j.1365-3059.2000.00494.x

CrossRef Полный текст | Google Scholar

Галлелли А., Талоччи С., Пилотти М. и Лорети С. (2014). Качественная ПЦР в реальном времени для обнаружения Pseudomonas syringae pv. actinidiae изолятов, вызывающих недавние вспышки бактериального рака киви. Plant Pathol. 63, 264–276. DOI: 10.1111 / ppa.12082

CrossRef Полный текст | Google Scholar

Голами А., Шахсавани С. и Незарат С. (2009). Влияние ризобактерий, способствующих росту растений (PGPR), на прорастание, рост рассады и урожай кукурузы. Внутр. J. Biol. Life Sci. 1, 35–40.

PubMed Аннотация | Google Scholar

Гулд, Э. М., Блэк, М. З., Кларк, Г., Таннер, Д. Дж., И Бендж, Дж. (2015). Инструменты для лечения бактериального рака киви Pseudomonas syringae pv actinidiae (Psa). Acta Hortic. 105, 39–46. DOI: 10.17660 / ActaHortic.2015.1105.6

CrossRef Полный текст | Google Scholar

Грин, С. А., Чен, X., Ньювенхейзен, Н. Дж., Матич, А. Дж., Ван, М. Ю., Банн, Б. Дж. И др. (2012). Идентификация, функциональная характеристика и регуляция фермента, ответственного за биосинтез цветочного (E) -неролидола в киви ( Actinidia chinensis ). J. Exp. Бот. 63, 1951–1967. DOI: 10.1093 / jxb / err393

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Молоток, Ø, Харпер, Д.А. Т. и Райан П. Д. (2001). ПРОШЛОЕ: Пакет программ палеонтологической статистики для обучения и анализа данных. Palaeontol. Электрон. 4, 1–9.

Google Scholar

Харви, К. Ф., и Фрейзер, Л. Г. (1988). Цветочная биология двух видов актинидий (Actinidiaceae). II. Ранняя эмбриология. Бот. Газ. 149, 37–44. DOI: 10.1086 / 337689

CrossRef Полный текст | Google Scholar

Хе З., Чжан Х., Чжун Ю. и Е Л. (2000). Филогенетические взаимоотношения актинидий и родственных родов на основе микроморфологических признаков лиственных трихом. Genet. Ресурс. Crop Evol. 47, 627–639. DOI: 10.1023 / A: 1026572524970

CrossRef Полный текст | Google Scholar

Himaman, W., Thamchaipenet, A., Pathom-aree, W., and Duangmal, K. (2016). Актиномицеты из эвкалипта и их биологическая активность в борьбе с фитофторозом листьев эвкалипта и побегами. Microbiol. Res. 188, 42–52. DOI: 10.1016 / j.micres.2016.04.011

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Хаупейдж, Д., Итхэнидж, В. В., и Спунер-Харт, Р. (1998). Распределение пыльцевых трубок пестика киви ( Actinidia deliciosa, A. Chev. C. F. Liang) в связи с его репродуктивным процессом. Ann. Бот. 81, 697–703. DOI: 10.1006 / anbo.1998.0615

CrossRef Полный текст | Google Scholar

Хуанг, Х. (2014). Род Actinidia: всемирная монография. Пекин: Science Press.

Google Scholar

Innerebner, G., Knief, C., and Vorholt, J.А. (2011). Защита Arabidopsis thaliana от патогенных листьев Pseudomonas syringae штаммами Sphingomonas в контролируемой модельной системе. Заявл. Environ. Microbiol. 77, 3202–3210. DOI: 10.1128 / AEM.00133-11

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Юнкер Р. Р., Лёвель К., Гросс Р., Дёттерль С., Келлер А. и Блютген Н. (2011). Состав эпифитных бактериальных сообществ на лепестках и листьях различается. Plant Biol. 13, 918–924. DOI: 10.1111 / j.1438-8677.2011.00454.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ким, Д., Хонг, С., Ким, Й.-Т., Рю, С., Ким, Х. Б., и Ли, Ж.-Х. (2018). Метагеномный подход к идентификации патогенов пищевого происхождения на пекинской капусте. J. Microbiol. Biotechnol. 28, 227–235. DOI: 10.4014 / jmb.1710.10021

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ким, М. Дж., Чон, К. В., Чо, Г., Ким, Д. Р., Квак, Ю. Б., Квак, Ю. С. (2018). Сравнение структуры микробного сообщества пыльцы киви. Plant Pathol. J. 34, 143–149. DOI: 10.5423 / PPJ.NT.12.2017.0281

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ким, Ю. К., Лево, Дж., Гарденер, Б. Б. М., Пирсон, Э. А., Пирсон, Л. С., и Рю, К. М. (2011). Многофакторная основа для укрепления здоровья растений с помощью ассоциированных с растениями бактерий. Заявл. Environ. Microbiol. 77, 1548–1555.DOI: 10.1128 / AEM.01867-10

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кинкель, Л. Л. (1997). Динамика микробной популяции на листьях. Annu. Rev. Phytopathol. 35, 327–347. DOI: 10.1146 / annurev.phyto.35.1.327

CrossRef Полный текст | Google Scholar

Кришнамурти К. и Гнанаманикам С. С. (1998). Биологический контроль заражения риса штаммом Pseudomonas fluorescens pf7-14: оценка маркерного гена и составов. Biol. Контроль 13, 158–165. DOI: 10.1006 / bcon.1998.0654

CrossRef Полный текст | Google Scholar

Кёдела В., Крейзар В. и Панкова И. (2010). Pseudomonas corrugata и Pseudomonas marginalis , связанные с гибелью растений томатов в гидропонной культуре из минеральной ваты. Защита растений. Sci. 46, 1–11. DOI: 10.17221 / 44/2009-PPS

CrossRef Полный текст | Google Scholar

Лево, Х. Дж., И Линдоу, С.Э. (2001). Аппетит эпифита: количественный мониторинг потребления бактериального сахара в филлосфере. Proc. Natl. Акад. Sci. США 98, 3446–3453. DOI: 10.1073 / pnas.061629598

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ли, X. С., Сато, Т., Ойва, Ю., Кусуми, А., Гу, Дж. Д., и Катаяма, Ю. (2010). Окисление элементарной серы штаммом Fusarium solani THIF01, несущим эндобактерии Bradyrhizobium sp. Microb. Ecol. 60, 96–104. DOI: 10.1007 / s00248-010-9699-1

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Линдоу, С. Э., и Брандл, М. Т. (2003). Микробиология филлосферы. Заявл. Environ. Microbiol. 69, 1875–1883. DOI: 10.1128 / AEM.69.4.1875-1883.2003

CrossRef Полный текст | Google Scholar

Лопес-Веласко, Г., Кардер, П. А., Велбаум, Г. Э., и Пондер, М. А. (2013). Разнообразие сперматозоидов и филлосферных бактериальных сообществ шпината ( Spinacia oleracea ). FEMS Microbiol. Lett. 346, 146–154. DOI: 10.1111 / 1574-6968.12216

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лопес-Веласко, Г., Велбаум, Г. Э., Фалькинхам, Дж. О., и Пондер, М. А. (2011). Структура бактериального сообщества филлосферы шпината ( Spinacia oleracea ) в зависимости от сорта и условий окружающей среды во время сбора урожая. Разнообразие 3, 721–738. DOI: 10.3390 / d3040721

CrossRef Полный текст | Google Scholar

Лион, С.Р., Гриффен А. Л. и Лейс Э. Дж. (2000). Количественная ПЦР в реальном времени на Porphyromonas gingivalis и общее количество бактерий. J. Clin. Microbiol. 38, 2362–2365.

Google Scholar

Ма, А., Львов, Д., Чжуан, X., и Чжуан, Г. (2013). Тушение кворума в культивируемых филлосферных бактериях табака. Внутр. J. Mol. Sci. 14, 14607–14619. DOI: 10.3390 / ijms140714607

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Михавила, Г., Адлер, К., Де Грегорио, П. Р., Лами, М. Дж., Карам, Ди Санто, М. С. и др. (2017). Pseudomonas protegens CS1 из филлосферы лимона в качестве кандидата на средство биологической борьбы с раком цитрусовых. Plant Biol. 19, 608–617. DOI: 10.1111 / plb.12556

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Mingma, R., Pathom-aree, W., Trakulnaleamsai, S., Thamchaipenet, A., and Duangmal, K. (2014). Выделение ризосферных и корневых эндофитных актиномицетов из бобовых растений и их активность по подавлению патогена сои Xanthomonas campestris pv.глицин. World J. Microbiol. Biotechnol. 30, 271–280. DOI: 10.1007 / s11274-013-1451-9

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Монье, Дж. М., и Линдоу, С. Э. (2004). Частота, размер и локализация скоплений бактерий на поверхности листьев фасоли. Заявл. Environ. Microbiol. 70, 346–355. DOI: 10.1128 / AEM.70.1.346-355.2004

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Мурильо Дж., Бардаджи Л., Наварро де ла Фуэнте, Л., Фюрер, М. Э., Агилера, С., и Альварес-Моралес, А. (2011). Вариация в сохранении кластера для биосинтеза фитотоксина фазеолотоксина в Pseudomonas syringae предполагает, по крайней мере, два события горизонтального накопления. Res. Microbiol. 162, 253–261. DOI: 10.1016 / j.resmic.2010.10.011

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Наджафи Пур, Г. и Тагави, С. М. (2011). Сравнение P. syringae pv.syringae от разных хозяев на основе патогенности и BOX-PCR в Иране. J. Agric. Sci. Technol. 13, 431-442.

Google Scholar

Nieuwenhuizen, N. J., Wang, M. Y., Matich, A. J., Green, S. A., Chen, X., Yauk, Y.-K., et al. (2009). Две терпен-синтазы ответственны за основные сесквитерпены, выделяемые цветками киви ( Actinidia deliciosa, ). J. Exp. Бот. 60, 3203–3219. DOI: 10.1093 / jxb / erp162

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Оттесен, А.R., González Peña, A., White, J. R., Pettengill, J. B., Li, C., Allard, S., et al. (2013). Базовое исследование анатомической микробной экологии важного пищевого растения: Solanum lycopersicum (томат). BMC Microbiol. 13: 114. DOI: 10.1186 / 1471-2180-13-114

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Паре, П. У., и Тумлинсон, Дж. Х. (1999). Летучие растения используются в качестве защиты от насекомых-травоядных. Завод. Physiol. 121, 325–332.DOI: 10.1104 / стр.121.2.325

CrossRef Полный текст | Google Scholar

Патель, Х. К., Ферранте, П., Ковачеуш, С., Ламба, Д., Скортичини, М., и Вентури, В. (2014). Возникающий патоген киви Pseudomonas syringae pv. actinidiae не производит AHL, но обладает тремя LuxR Solos. PLoS One 9: e87862. DOI: 10.1371 / journal.pone.0087862

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Петриччоне, М., Зампелла, Л., Мастробуони, Ф., и Скортичини, М. (2017). Появление медьрезистентных Pseudomonas syringae pv. syringae, выделенные из дождевых садов и садов киви, также инфицированных P. s. pv. актинидии . Eur. Дж. Плант. Патол. 149, 953–968. DOI: 10.1007 / s10658-017-1246-1

CrossRef Полный текст | Google Scholar

Prapagdee, B., Kuekulvong, C., and Mongkolsuk, S. (2008). Противогрибковый потенциал внеклеточных метаболитов, продуцируемых Streptomyces hygroscopicus против фитопатогенных грибов. Внутр. J. Biol. Sci. 4, 330–337. DOI: 10.7150 / ijbs.4.330

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Pruesse, E., Quast, C., Knittel, K., Fuchs, B.M., Ludwig, W., Peplies, J., et al. (2007). SILVA: всеобъемлющий онлайн-ресурс для проверенных и согласованных данных о последовательностях рибосомных РНК, совместимых с ARB. Nucleic Acids Res. 35, 7188–7196. DOI: 10.1093 / nar / gkm864

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Растоги, Г., Коакер, Г. Л., и Лево, Дж. Х. Дж. (2013). Новое понимание структуры и функции микробиоты филлосферы с помощью высокопроизводительных молекулярных подходов. FEMS Microbiol. Lett. 348, 1–10. DOI: 10.1111 / 1574-6968.12225

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Rastogi, G., Sbodio, A., Tech, J. J., Suslow, T. V., Coaker, G. L., and Leveau, J.H.J. (2012). Микробиота листьев в агроэкосистеме: пространственно-временные изменения в составе бактериального сообщества на выращиваемом в поле салате. ISME J. 6, 1812–1822. DOI: 10.1038 / ismej.2012.32

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ренци М., Копини П., Таддеи А. Р., Россетти А., Галлиполи Л., Маццалья А. и др. (2012). Бактериальный рак киви в Италии: анатомические изменения древесины и первичных очагов инфекции. Фитопатология 102, 827–840. DOI: 10.1094 / PHYTO-02-12-0019-R

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ротоло, К., Анджелини, Р. М. Д. М., Полластро, С., и Фартра, Ф. (2016). Анализ количественной ПЦР на основе TaqMan для количественного определения агентов биоконтроля Bacillus subtilis , штамм QST 713 и Bacillus amyloliquefaciens subsp. plantarum штамм D747. BioControl 61, 91–101. DOI: 10.1007 / s10526-015-9701-4

CrossRef Полный текст | Google Scholar

Ryu, C. M., Farag, M. A., Hu, C. H., Reddy, M. S., Wei, H. X., Paré, P. W., et al. (2003).Летучие бактерии способствуют росту Arabidopsis. Proc. Natl. Акад. Sci. США 100, 4927–4932. DOI: 10.1073 / pnas.0730845100

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Сарма, Б. К., Ядав, С. К., Сингх, С., и Сингх, Х. Б. (2015). Защита растений от фитопатогенов, опосредованная микробным консорциумом: переадресация для повышения эффективности. Soil Biol. Биохим. 87, 25–33. DOI: 10.1016 / j.soilbio.2015.04.001

CrossRef Полный текст | Google Scholar

Савита, Ю.Л., Прити, Д. М., Сандип, К., Мулла, С. Р., Суварна, В. К., и Суреш, К. К. (2013). Изучение биоконтрольной активности Lactobacillus plantarum против грибковых патогенов. J. Pure Appl. Microbiol. 7, 3235–3237.

Google Scholar

Скарпеллини М., Францетти Л. и Галли А. (2004). Разработка метода ПЦР для идентификации Pseudomonas fluorescens и его биотипа. FEMS Microbiol. Lett. 236, 257–260. DOI: 10.1111 / j.1574-6968.2004.tb09655.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Schloss, P.Д., Весткотт, С. Л., Рябин, Т., Холл, Дж. Р., Хартманн, М., Холлистер, Э. Б. и др. (2009). Представляем mothur: программное обеспечение с открытым исходным кодом, независимое от платформы, поддерживаемое сообществом для описания и сравнения сообществ микробов. Заявл. Environ. Microbiol. 75, 7537–7541. DOI: 10.1128 / AEM.01541-09

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Скортичини, М. (2016). Полевая эффективность цинк-медь-гидрокислоты биокомплекса лимонной кислоты для уменьшения просачивания от зимних язв, вызванных Pseudomonas syringae pv. actinidiae к Actinidia spp. J. Plant Pathol. 98, 651–655.

Google Scholar

Скортичини М., Марселлетти С., Ферранте П., Петриччионе М. и Фиррао Г. (2012). Pseudomonas syringae pv. actinidiae : вновь появляющийся, многогранный пандемический патоген. Мол. Завод Патол. 13, 631–640. DOI: 10.1111 / j.1364-3703.2012.00788.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Шарифазизи, М., Хариги Б. и Садеги А. (2017). Оценка биологической борьбы с Erwinia amylovora, возбудителем бактериального ожога груши, вызываемого бактериями-антагонистами. Biol. Контроль 104, 28–34. DOI: 10.1016 / j.biocontrol.2016.10.007

CrossRef Полный текст | Google Scholar

Спинелли, Ф., Чамполини, Ф., Крести, М., Гейдер, К., и Коста, Г. (2005). Влияние стигматической морфологии на колонизацию цветов Erwinia amylovora и Pantoea agglomerans . Eur. J. Plant Pathol. 113, 395–405. DOI: 10.1007 / s10658-005-4511-7

CrossRef Полный текст | Google Scholar

Спинелли, Ф., Донати, И., Ваннест, Дж. Л., Коста, М., и Коста, Г. (2011). Мониторинг в реальном времени взаимодействия между Pseudomonas syringae pv actinidiae и видами актинидий. Acta Hort. 913, 461–465. DOI: 10.17660 / ActaHortic.2011.913.61

CrossRef Полный текст

Стоквелл, В. О., Джонсон, К.Б., Шугар Д. и Лопер Дж. Э. (2011). Механически совместимые смеси бактериальных антагонистов улучшают биологический контроль бактериального ожога груши. Фитопатология 101, 113–123. DOI: 10.1094 / PHYTO-03-10-0098

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Тацука К., Суекане С., Сакаи Ю. и Сумитани Х. (1990). Летучие компоненты цветков киви: одновременная дистилляция и экстракция по сравнению с отбором проб в свободном пространстве. J. Agric.Food Chem. 38, 2176–2180. DOI: 10.1021 / jf00102a015

CrossRef Полный текст | Google Scholar

Терци В., Морсия К., Фаччиоли П., Вале Г., Таккони Г. и Малнати М. (2007). Противогрибковая активность эфирного масла чайного дерева ( Melaleuca alternifolia ) и его основных компонентов против патогенов растений in vitro. Lett. Прил. Microbiol. 44, 613–618. DOI: 10.1111 / j.1472-765X.2007.02128.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Тапа, С., Прасанна, Р., Ранджан, К., Велмуруган, К., и Рамакришнан, Б. (2017). Питательные вещества и свойства хозяина влияют на численность и функциональные характеристики микробиома филлосферы риса. Microbiol. Res. 204, 55–64. DOI: 10.1016 / j.micres.2017.07.007

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Untergasser, A., Cutcutache, I., Koressaar, T., Ye, J., Faircloth, B.C., Remm, M., et al. (2012). Primer3 — новые возможности и интерфейсы. Nucleic.Acids Res. 40: e115. DOI: 10.1093 / nar / gks596

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ваннест, Дж. Л. (2012). Pseudomonas syringae pv. actinidiae (Psa): угроза для Новой Зеландии и мировой индустрии киви. Новое. Рвение. J. Crop. Hortic. Sci. 40, 265–267. DOI: 10.1080 / 01140671.2012.736084

CrossRef Полный текст | Google Scholar

Vayssier-Taussat, M., Albina, E., Citti, C., Cosson, J.F., Jacques, M.A., Lebrun, M.H., et al. (2014). Сдвиг парадигмы с патогенов на патобиом: новые концепции в свете мета-омики. Фронт. Cell Infect. Microbiol. 4:29. DOI: 10.3389 / fcimb.2014.00029

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Volksch, B., and May, R. (2001). Биологический контроль Pseudomonas syringae pv. glycinea эпифитными бактериями в полевых условиях. Microbiol. Ecol. 41, 132–139.

PubMed Аннотация | Google Scholar

Whipps, J. M., Hand, P., Pink, D., and Bending, G. D. (2008). Микробиология филлосферы с особым упором на разнообразие и генотип растений. J. Appl. Microbiol. 105, 1744–1755. DOI: 10.1111 / j.1365-2672.2008.03906.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Wicaksono, W. A., Jones, E. E., Casonato, S., Monk, J., and Ridgway, H. J. (2018). Биологический контроль Pseudomonas syringae pv. actinidiae (Psa), возбудитель бактериального рака киви, с использованием эндофитных бактерий, выделенных из лекарственного растения. Biol. Контроль 116, 103–112. DOI: 10.1016 / j.biocontrol.2017.03.003

CrossRef Полный текст | Google Scholar

Янг, Т., Стоопен, Г., Ялпани, Н., Вервурт, Дж., Де Вос, Р., Фостер, А. и др. (2011). Метаболическая инженерия герановой кислоты в кукурузе для достижения устойчивости к грибам нарушена новыми моделями гликозилирования. Metab. Англ. 13, 414–425. DOI: 10.1016 / j.ymben.2011.01.011

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Яширо Э. и Макманус П. С. (2012). Влияние обработки стрептомицином на структуру бактериального сообщества в филлосфере яблони. PLoS One 7: e37131. DOI: 10.1371 / journal.pone.0037131

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Засуха и выбор хозяев влияют на динамику бактериального сообщества в микробиоме корней травы

  • Алеклетт К., Лефф Дж. В., Фирер Н., Харт М.(2015). Дикие виды растений, произрастающие в тесной связи на субальпийском лугу, являются хозяевами различных корневых бактериальных сообществ. PeerJ 3 : e804.

    Артикул

    Google Scholar

  • Bacchetti De Gregoris T, Aldred N, Clare AS, Burgess JG. (2011). Улучшение специфичных для филумов и классов праймеров для количественной оценки бактериальных таксонов с помощью ПЦР в реальном времени. Дж. Микробиологические методы 86 : 351–356.

    CAS
    Статья

    Google Scholar

  • Бадри Д.В., Чапарро Дж. М., Чжан Р., Шен К., Виванко Дж. М.. (2013). Внесение в почву природных смесей фитохимических веществ, полученных из корневых экссудатов арабидопсиса, показывает, что фенольные соединения преимущественно модулируют микробиом почвы. J Biol Chem 288 : 4502–4512.

    CAS
    Статья

    Google Scholar

  • Барнард Р.Л., Осборн, Калифорния, Файерстоун, МК.(2013). Реакция почвенных бактериальных и грибковых сообществ на сильное высыхание и повторное заболачивание. ISME J 7 : 2229–2241.

    CAS
    Статья

    Google Scholar

  • Beckers B, Op De Beeck M, Weyens N, Boerjan W, Vangronsveld J. (2017). Структурная изменчивость и дифференциация ниш в ризосферном и эндосферном бактериальном микробиоме полевых деревьев тополя. Микробиом 5 : 25.

    Артикул

    Google Scholar

  • Берендсен Р.Л., Питерс CMJ, Баккер ПАУМ. (2012). Микробиом ризосферы и здоровье растений. Trends Plant Sci 17 : 478–486.

    CAS
    Статья

    Google Scholar

  • Berg G, Grube M, Schloter M, Smalla K. (2014). Раскрытие микробиома растений: взгляд в прошлое и перспективы на будущее. Передний микробиол 5 : 148.

    PubMed
    PubMed Central

    Google Scholar

  • Berg G, Rybakova D, Grube M, Köberl M. (2016). Исследованный микробиом растений: значение для экспериментальной ботаники. J Exp Bot 67 : 995–1002.

    CAS
    Статья

    Google Scholar

  • Берг Г., Смолла К. (2009). Виды растений и тип почвы совместно формируют структуру и функцию микробных сообществ в ризосфере: виды растений, тип почвы и сообщества ризосферы. FEMS Microbiol Ecol 68 : 1–13.

    CAS
    Статья

    Google Scholar

  • Bergey’s MO. (2010) The Bacteroidetes, Spirochaetes, Tenericutes (Mollicutes), Acidobacteria, Fibrobacteres, Fusobacteria, Dictyoglomi, Gemmatimonadetes, Lentisphaerae, Verrucomicrobia, Chlamydiae и Planctomycetes . Доступно по адресу: http://www.academia.edu/download/44794212/Noel_R._Krieg__Wolfgang_Ludwig__William_B._WhitmaBookZZ.org.pdf (последний доступ 30 декабря 2016 г.).

  • Blazewicz SJ, Schwartz E, Firestone MK. (2014). Рост и гибель бактерий и грибов лежат в основе импульсов углекислого газа, вызываемых дождями из сезонно высушенной почвы. Экология 95 : 1162–1172.

    Артикул

    Google Scholar

  • Bouffaud M-L, Kyselková M, Gouesnard B, Grundmann G, Muller D, MoëNne-Loccoz Y. (2012). Влияет ли история диверсификации кукурузы на отбор почвенных бактерий корнями ?: Диверсификация кукурузы и корневые бактерии. Mol Ecol 21 : 195–206.

    Артикул

    Google Scholar

  • Bouffaud M-L, Poirier M-A, Muller D, Moënne-Loccoz Y. (2014). Корневой микробиом связан с эволюцией растений-хозяев кукурузы и других Poaceae: эволюция Poaceae и корневые бактерии. Environ Microbiol 16 : 2804–2814.

    Артикул

    Google Scholar

  • Bouskill NJ, Lim HC, Borglin S, Salve R, Wood TE, Silver WL и др. .(2013). Предварительное воздействие засухи повышает устойчивость бактериальных сообществ почв тропических лесов к продолжительной засухе. ISME J 7 : 384–394.

    CAS
    Статья

    Google Scholar

  • Бускилл, Нью-Джерси, Вуд TE, Баран Р., Йе З., Боуэн Б.П., Лим Х. и др. . (2016). Подземный ответ на засуху в почве тропического леса. I. Изменения функционального потенциала и метаболизма микробов. Передний микробиол 7 : 525.

    PubMed
    PubMed Central

    Google Scholar

  • Brusetti L, Francia P, Bertolini C, Pagliuca A, Borin S, Sorlini C et al . (2005). Бактериальные сообщества, ассоциированные с ризосферой трансгенной кукурузы Bt 176 ( Zea mays и его нетрансгенного аналога. Почва растений 266 : 11–21.

    Статья

    Google Scholar

  • Bulgarelli D, Garrido-Oter R, Münch PC, Weiman A, Dröge J, Pan Y et al .(2015). Структура и функция микробиоты бактериальных корней дикого и одомашненного ячменя. Клеточный микроб-хозяин 17 : 392–403.

    CAS
    Статья

    Google Scholar

  • Bull AT, Asenjo JA. (2013). Микробиология гиперзасушливых сред: недавние открытия из пустыни Атакама, Чили. Антони Ван Левенгук 103 : 1173–1179.

    CAS
    Статья

    Google Scholar

  • Буш MJ, Tschowri N, Schlimpert S, Flärdh K, Buttner MJ.(2015). Передача сигналов c-di-GMP и регуляция переходов в развитии у стрептомицетов. Nat Rev Microbiol 13 : 749–760.

    CAS
    Статья

    Google Scholar

  • Casanovas EM, Barassi CA, Sueldo RJ. (2002). Инокуляция азоспирилл снижает воздействие водного стресса на проростки кукурузы. Cereal Res Commun 30 : 343–350.

    Google Scholar

  • Кавальери Л., Орландо Дж., Этчеверри М.(2009). Структура микробного сообщества ризосферы на разных стадиях роста растений кукурузы и в местах расположения корней. Microbiol Res 164 : 391–399.

    Артикул

    Google Scholar

  • Чапарро Дж. М., Бадри Д. В., Баккер М. Г., Сугияма А., Мантер Д. К., Виванко Дж. М.. (2013). Экссудация фитохимических веществ из корней арабидопсиса следует определенным закономерностям, которые запрограммированы в процессе развития и коррелируют с микробными функциями почвы. PLoS One 8 : e55731.

    CAS
    Статья

    Google Scholar

  • Cherif H, Marasco R, Rolli E, Ferjani R, Fusi M, Soussi A et al . (2015). Земледелие в пустыне Oasis отбирает эндофитные сообщества корней финиковой пальмы и культивируемые бактерии, которые способствуют устойчивости к засухе: эндофиты пальм Oasis способствуют устойчивости к засухе. Environ Microbiol Rep 7 : 668–678.

    CAS
    Статья

    Google Scholar

  • Coleman-Derr D, Desgarennes D, Fonseca-Garcia C, Gross S, Clingenpeel S, Woyke T et al . (2016). Компартмент растений и биогеография влияют на состав микробиома у культивируемых и местных видов агавы . Новый Фитол 209 : 798–811.

    CAS
    Статья

    Google Scholar

  • Dayan FE, Rimando AM, Pan Z, Baerson SR, Gimsing AL, Duke SO.(2010). Сорголеон. Фитохимия 71 : 1032–1039.

    CAS
    Статья

    Google Scholar

  • de Gonzalo G, Colpa DI, Habib MHM, Fraaije MW. (2016). Бактериальные ферменты, участвующие в деградации лигнина. J Biotechnol 236 : 110–119.

    CAS
    Статья

    Google Scholar

  • Desgarennes D, Garrido E, Torres-Gomez MJ, Peña-Cabriales JJ, Partida-Martinez LP.(2014). Диазотрофный потенциал среди бактериальных сообществ, связанных с дикими и культивируемыми видами агавы . FEMS Microbiol Ecol 90 : 844–857.

    CAS
    Статья

    Google Scholar

  • Dombrowski N, Schlaeppi K, Agler MT, Hacquard S, Kemen E, Garrido-Oter R et al . (2017). Динамика корневой микробиоты многолетника Arabis alpina зависит от времени пребывания в почве, но не зависит от времени цветения. ISME J 11 : 43–55.

    CAS
    Статья

    Google Scholar

  • Дюфрен М, Лежандр П. (1997). Видовые сообщества и индикаторные виды: необходимость гибкого асимметричного подхода. Ecol Monogr 67 : 345–366.

    Google Scholar

  • Эдвардс Дж., Джонсон С., Сантос-Медельин С., Лурье Е., Подишетти Н.К., Бхатнагар С. и др. .(2015). Структура, вариация и сборка корневых микробиомов риса. Proc Natl Acad Sci USA 112 : E911 – E920.

    CAS
    Статья

    Google Scholar

  • Клык Y, Xiong L. (2015). Общие механизмы засухоустойчивости и их применение для повышения засухоустойчивости растений. Cell Mol Life Sci 72 : 673–689.

    CAS
    Статья

    Google Scholar

  • Fierer N, Schimel JP, Holden PA.(2003). Вариации в составе микробного сообщества по двум профилям глубины почвы. Soil Biol Biochem 35 : 167–176.

    CAS
    Статья

    Google Scholar

  • Фонсека-Гарсия С, Коулман-Дерр Д., Гарридо Е, Визель А, Триндж С.Г., Партида-Мартинес ЛП. (2016). Микробиом кактусов: взаимодействие между фильтрацией среды обитания и специфичностью хозяина. Передний микробиол 7 : 150.

    Артикул

    Google Scholar

  • Гайеро-младший, Макколл, Калифорния, Томпсон, Калифорния, Дэй, штат Нью-Джерси, Лучший AS, Данфилд К.Э.(2013). Внутри корневого микробиома: бактериальные эндофиты корня и стимуляция роста растений. Am J Bot 100 : 1738–1750.

    Артикул

    Google Scholar

  • Галл H, Филипп F, Domon J-M, Gillet F, Pelloux J, Rayon C. (2015). Метаболизм клеточной стенки в ответ на абиотический стресс. Растения 4 : 112–166.

    Артикул

    Google Scholar

  • Готби-Раванди А.А., Шахбази М., Шариати М., Муло П.(2014). Влияние слабого и сильного стресса засухи на эффективность фотосинтеза у толерантных и восприимчивых генотипов ячменя ( Hordeum vulgare L.). J Agron Crop Sci 200 : 403–415.

    CAS
    Статья

    Google Scholar

  • Рабочая группа по филогении травы II. (2012). Новая филогения травы разрешает глубокие эволюционные отношения и обнаруживает происхождение C4. Новый Фитол 193 : 304–312.

    Артикул

    Google Scholar

  • Hayden HL, Mele PM, Bougoure DS, Allan CY, Norng S, Piceno YM и др. . (2012). Изменения в структуре микробного сообщества бактерий, архей и грибов в ответ на повышенный уровень CO2 и потепление в почве австралийских пастбищ: влияние изменения климата на микробные сообщества. Environ Microbiol 14 : 3081–3096.

    CAS
    Статья

    Google Scholar

  • Komeil D, Simao-Beaunoir A-M, Beaulieu C.(2013). Обнаружение потенциальных генов, кодирующих субериназу, у штаммов Streptomyces scabiei и других актинобактерий. Can J Microbiol 59 : 294–303.

    CAS
    Статья

    Google Scholar

  • Куске С.Р., Тикнор Л.О., Миллер М.Э., Данбар Дж. М., Дэвис Дж. А., Барнс С. М. и др. . (2002). Сравнение почвенных бактериальных сообществ в ризосферах трех видов растений и в промежутках между засушливыми пастбищами. Appl Environ Microbiol 68 : 1854–1863.

    CAS
    Статья

    Google Scholar

  • Lesk C, Rowhani P, Ramankutty N. (2016). Влияние экстремальных погодных катаклизмов на мировое растениеводство. Природа 529 : 84–87.

    CAS
    Статья

    Google Scholar

  • Lundberg DS, Lebeis SL, Paredes SH, Yourstone S, Gehring J, Malfatti S et al .(2012). Определение основного микробиома корня Arabidopsis thaliana . Природа 488 : 86–90.

    CAS
    Статья

    Google Scholar

  • Marasco R, Rolli E, Ettoumi B, Vigani G, Mapelli F, Borin S и др. . (2012). Микробиом, способствующий засухоустойчивости, отбирается корневой системой при земледелии в пустыне. PLoS One 7 : e48479.

    CAS
    Статья

    Google Scholar

  • McCormick JR, Flärdh K.(2012). Сигналы и регуляторы, управляющие развитием Streptomyces . FEMS Microbiol Ред. 36 : 206–231.

    CAS
    Статья

    Google Scholar

  • Несснер Кавамура V, Taketani RG, Lançoni MD, Andreote FD, Mendes R, Soares de Melo I. (2013). Водный режим влияет на объемную почву и ризосферу бактериальных сообществ cereus jamacaru в биоме бразильской Каатинга. PLoS One 8 : e73606.

    Артикул

    Google Scholar

  • Nezhadahmadi A, Prodhan ZH, Faruq G. (2013). Засухоустойчивость пшеницы. Sci World J 2013 : 1–12.

    Артикул

    Google Scholar

  • Паркер М.А., Спирк Дж. М.. (1998). Географическая структура родовых ассоциаций в растительно-бактериальном мутуализме. Дж. Эвол Биол 11 : 549–562.

    Артикул

    Google Scholar

  • Пирс Д., Ходжсон Д., Торн М., Бернс Дж., Кокелл С. (2013). Предварительный анализ жизни в отложениях бывшего подледникового озера в Антарктиде. Разнообразие 5 : 680–702.

    Артикул

    Google Scholar

  • Пайффер Дж.А., Спор А, Корен О, Джин З., Триндж С.Г., Дангл Дж.Л. и др. . (2013). Разнообразие и наследуемость микробиома ризосферы кукурузы в полевых условиях. Proc Natl Acad Sci USA 110 : 6548–6553.

    CAS
    Статья

    Google Scholar

  • Philippot L, Raaijmakers JM, Lemanceau P, van der Putten WH. (2013). Возвращаясь к истокам: микробная экология ризосферы. Nat Rev Microbiol 11 : 789–799.

    CAS
    Статья

    Google Scholar

  • Полд G, Биллингс А.Ф., Бланшар Дж. Л., Буркхардт Д. Б., Фрей С. Д., Мелилло Дж. М. и др. .(2016). Долгосрочное потепление изменяет потенциал деградации углеводов в лесных почвах умеренного пояса. Appl Environ Microbiol 82 : 6518–6530.

    CAS
    Статья

    Google Scholar

  • Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T., Yarza P et al . (2013). Проект базы данных генов рибосомных РНК SILVA: улучшенная обработка данных и веб-инструменты. Nucleic Acids Res 41 : D590 – D596.

    CAS
    Статья

    Google Scholar

  • Раскован Н., Карбонетто Б., Перриг Д., Диас М., Канчиани В., Абало М. и др. . (2016). Комплексный анализ корневых микробиомов сои и пшеницы с сельскохозяйственных полей. Sci Rep 6 : 28084.

    CAS
    Статья

    Google Scholar

  • Rich SM, Ватт M. (2013). Состояние почвы и архитектура корневой системы злаков: обзор и соображения по поводу связи Дарвина и Уивера. J Exp Bot 64 : 1193–1208.

    CAS
    Статья

    Google Scholar

  • Sabadin PK, Malosetti M, Boer MP, Tardin FD, Santos FG, Guimarães CT et al . (2012). Изучение генетической основы засухоустойчивости сорго с помощью контролируемых стрессовых испытаний и поправок на фенологические различия и различия в высоте растений. Theor Appl Genet 124 : 1389–1402.

    CAS
    Статья

    Google Scholar

  • Samad A, Trognitz F, Compant S, Antonielli L, Sessitsch A.(2017). Общее и специфическое для хозяина разнообразие микробиома и функционирование виноградной лозы и сопутствующих сорных растений: микробные сообщества, связанные с виноградной лозой и сорняками виноградников. Environ Microbiol 19 : 1407–1424.

    Артикул

    Google Scholar

  • Schlaeppi K, Dombrowski N, Oter RG, Ver Loren van Themaat E, Schulze-Lefert P. (2014). Количественное расхождение микробиоты бактериальных корней у сородичей Arabidopsis thaliana . Proc Natl Acad Sci USA 111 : 585–592.

    CAS
    Статья

    Google Scholar

  • Шакья М., Готтель Н., Кастро Х, Ян З. К., Гюнтер Л., Лаббе Дж. и др. . (2013). Многофакторный анализ структуры грибных и бактериальных сообществ в корневом микробиоме зрелых деревьев populus deltoides. PLoS One 8 : e76382.

    CAS
    Статья

    Google Scholar

  • Sheik CS, Beasley WH, Elshahed MS, Zhou X, Luo Y, Krumholz LR.(2011). Влияние потепления и засухи на микробные сообщества пастбищ. ISME J 5 : 1692–1700.

    CAS
    Статья

    Google Scholar

  • Ши С., Ричардсон А.Э., О’Каллаган М., ДеАнгелис К.М., Джонс Е.Е., Стюарт А. и др. . (2011). Влияние отдельных компонентов корневого экссудата на бактериальные сообщества почвы: компоненты корневого экссудата и микробные сообщества почвы. FEMS Microbiol Ecol 77 : 600–610.

    CAS
    Статья

    Google Scholar

  • Соланс М. (2007). Discaria trinervis — Содействие симбиозу франкии сапрофитными актиномицетами. J Basic Microbiol 47 : 243–250.

    Артикул

    Google Scholar

  • de Souza RSC, Okura VK, Armanhi JSL, Jorrín B, Lozano N, da Silva MJ и др. . (2016). Разблокирование бактериальных и грибковых сообществ микробиома сахарного тростника. Sci Rep 6 : 28774.

    Артикул

    Google Scholar

  • Стивенсон А., Холлсворт Дж. Э. (2014). Водно-температурные отношения почвенных актинобактерий: водно-температурные отношения актинобактерий. Environ Microbiol Rep 6 : 744–755.

    CAS
    Статья

    Google Scholar

  • Такахаши С., Томита Дж., Нисиока К., Хисада Т., Нисидзима М.(2014). Разработка прокариотического универсального праймера для одновременного анализа бактерий и архей с использованием секвенирования нового поколения. PLoS One 9 : e105592.

    Артикул

    Google Scholar

  • Такетани Р.Г., Кавамура В.Н., Мендес Р., Мело И.С. (2015). Функциональная конгруэнтность микробных сообществ ризосферы, связанных с бобовыми деревьями из бразильской семиаридной области: функциональная конгруэнтность в семиаридной зоне. Environ Microbiol Rep 7 : 95–101.

    CAS
    Статья

    Google Scholar

  • Taketani RG, Lançoni MD, Kavamura VN, Durrer A, Andreote FD, Melo IS. (2016). Сухой сезон ограничивает бактериальное филогенетическое разнообразие в полузасушливой системе ризосферы. Microb Ecol 73 : 153–161.

    Артикул

    Google Scholar

  • terHorst CP, Lennon JT, Lau JA.(2014). Относительная важность быстрой эволюции для взаимодействия растений и микробов зависит от экологического контекста. Proc R Soc Ser B 281 : 20140028–20140028.

    Артикул

    Google Scholar

  • Уддин MR, Park SU, Dayan FE, Pyon JY. (2014). Гербицидная активность сформулированного сорголеона, натурального продукта экссудата корня сорго: гербицидный эффект сформулированного сорголеона. Pest Manag Sci 70 : 252–257.

    CAS
    Статья

    Google Scholar

  • Ushio M, Wagai R, Balser TC, Chinaama K. (2008). Вариации микробного состава почвенного микробного сообщества экосистемы тропических горных лесов: имеет ли значение виды деревьев? Soil Biol Biochem 40 : 2699–2702.

    CAS
    Статья

    Google Scholar

  • Яндигери М.С., Мина К.К., Сингх Д., Мальвия Н., Сингх Д.П., Соланки М.К. и др. .(2012). Засухоустойчивые эндофитные актинобактерии способствуют росту пшеницы ( Triticum aestivum в условиях водного стресса. Регулирование роста растений 68 : 411–420.

    CAS
    Статья

    Google Scholar

  • Ян И-В, Чен М-К, Ян Би, Хуанг Х-Дж, Чжан Х-Р, Хэ L-Q и др. . (2015). Использование праймеров, ориентированных на ген 16 S рРНК, для ПЦР-анализа в реальном времени преобладающих бактерий в фекалиях мышей. Appl Environ Microbiol 81 : 6749–6756.

    CAS
    Статья

    Google Scholar

  • эль Захар Хайчар Ф., Марол С., Берге О., Ранжель-Кастро Дж. И., Проссер Дж. И., Балесдент Дж. и др. . (2008). Среда обитания растений-хозяев и корневые экссудаты формируют структуру бактериального сообщества почвы. ISME J 2 : 1221–1230.

    Артикул

    Google Scholar

  • Межвидовая инфекция вирофага посредством отбора мутантов подавляет размножение гигантского вируса, способствуя выживанию клетки-хозяина

    Первые свидетельства межвидовой инфекции вирофага

    Мы использовали дальних родственников мимивирусов 17 , Tupanvirus Deep Ocean и Tupanvirus Soda Lake, в качестве моделей для изучения диапазона вирофагов-хозяев и их способности реплицироваться в амебах, инфицированных другими мимивирусами, кроме тех, которые принадлежат к трем линиям (A, B и C) семейства Mimiviridae 19 .Три вирофага, охарактеризованные в более ранних исследованиях, были проанализированы с помощью этих гигантских вирусов, включая вирофаги Гуарани, Спутник и Замилон 6,9,14 . Эти вирофаги ранее размножались в клетках Acanthamoeba castellanii , коинфицированных мимивирусами, а затем очищенных. Клетки A. castellanii инокулировали каждым штаммом тупанвируса при множественности инфицирования (MOI) 10. Для каждого вирофага использовали одинаковый MOI. Затем репликацию каждого вирофага оценивали с помощью количественной ПЦР (кПЦР) через 0, 24 часа (ч) и 48 часов после инфицирования (стр.я.). Наконец, увеличение количества ДНК вирофага было рассчитано с использованием метода дельта Ct с учетом моментов времени 0 и 48 ч p.i. Спутник и Замилон смогли инфицировать и размножаться как тупанвирусами Deep Ocean, так и тупанвирусами содового озера (рис. 1а, b). Неожиданно не удалось обнаружить репликацию гуарани с Tupanvirus Deep Ocean или Tupanvirus Soda Lake (рис. 1a, b).

    Рис. 1: Расширенный круг хозяев гуарани, выделенных из сокультуры тупанвируса.

    a , b Гистограммы, изображающие репликацию генома во время первичного культивирования гуарани, замилона и спутника Acanthamoeba castellanii , коинфицированных тупанвирусами. a Репликация вирофагов с помощью Tupanvirus Deep Ocean. b Репликация вирофагов с помощью Tupanvirus Soda Lake. c , d Графики, изображающие репликацию генома гуарани, выделенного из супернатантов тупанвируса в Acanthamoeba castellanii , коинфицированных каждым штаммом тупанвируса. c Гуарани, выделенный из супернатанта Tupanvirus Deep Ocean. d Гуарани, выделенный из супернатанта Tupanvirus Soda Lake. Репликация ДНК каждого вирофага через 0, 24 и 48 ч.я. был измерен с помощью количественной ПЦР в реальном времени (для ( c ) и ( d ) здесь показаны только времена 0 и 48 p.i.). Затем рассчитывали увеличение количества ДНК вирофага (кратность индукции) с использованием метода дельта Ct с учетом разницы между значениями Ct, специфичными для каждого вирофага, в моменты времени H0 и h58. Амебы, инфицированные только каждым тупанвирусом, использовали в качестве отрицательного контроля. Все ПЦР, нацеленные на эти контроли, были отрицательными при временах H0, h34 и h58. Планки погрешностей, стандартное отклонение ( n = 3 биологически независимых эксперимента).Н.М .: Без умножения.

    После лизиса клеток-хозяев, коинфицированных гуарани и тупанвирусом Deep Ocean или тупанвирусом содового озера, супернатант каждой культуры фильтровали через фильтры с размером пор 0,22 мкм для удаления гигантских вирусных частиц. Полученные супернатанты, содержащие только частицы гуарани, впоследствии использовали для заражения свежих клеток A. castellanii , одновременно инокулированных Tupanvirus Deep Ocean или Tupanvirus Soda Lake при MOI 10. Затем репликацию вирофага измеряли с помощью qPCR.В этих анализах гуарани заметно инфицированы и успешно реплицировались как с Tupanvirus Deep Ocean, так и с Tupanvirus Soda Lake только после одного пассажа с каждым вирусом (рис. 1c, d). Мы интерпретировали этот феномен как результат механизма отбора мутантов, приводящего к расширению диапазона хозяев, что позволило гуарани реплицироваться с новыми вирусными хозяевами, ранее устойчивыми к этому вирофагу. Небольшая часть популяции гуарани в наших стадах, вероятно, состояла из эмерджентного мутанта, способного инфицировать тупанвирус.Мы обнаружили, что гуарани, выделенный из супернатанта культуры Tupanvirus Deep Ocean, способен реплицироваться с Tupanvirus Soda Lake и , наоборот, . Взятые вместе, эти результаты представляют, насколько нам известно, первое свидетельство межвидовой передачи вирофагов между мимивирусами и их дальними родственниками.

    Мутация потенциального диапазона хозяев, связанная с приобретением хозяина

    В бактериофагах расширение диапазона хозяев включает несколько молекулярных путей. Действительно, спонтанные или индуцированные мутации в гене волокна длинного хвоста позволили некоторым фагам инфицировать новых бактериальных хозяев 20,21,22,23,24 .Чтобы определить генетические особенности, ответственные за расширенный диапазон хозяев гуарани, мы секвенировали геном этого вирофага, полученный до и после пассажа с каждым тупанвирусом. Геном гуарани состоит из генома дцДНК из 18 967 пар оснований, кодирующих 22 предсказанных гена, очень похожих на Sputnik 14 . Мы обнаружили, что вирофаг, выделенный из супернатанта мимивируса Acanthamoeba polyphaga (APMV), не имеет мутаций в своем геноме по сравнению с исходным штаммом, который мы секвенировали ранее 14 .Поэтому мы считаем этот штамм генотипом вирофага дикого типа. Интересно, что анализ генома гуарани, выделенного из супернатанта тупанвируса, выявил появление новой субпопуляции вирофага, в геноме которой обнаружена делеция. Эта делеция состоит из потери последовательности длиной 81 нуклеотид, расположенной в ORF 8, которая кодирует коллагеноподобный белок (дополнительный рисунок 1, дополнительные данные 1, 2). Делеция была обнаружена у гуарани, очищенного как от Tupanvirus Deep Ocean, так и от Tupanvirus Soda Lake.Затем мы стремились подтвердить результаты эксперимента по секвенированию, разработав систему ПЦР, нацеленную на сайт делеции, как показано на рис. 2а. Нам удалось подтвердить наличие двух генотипов гуарани, выделенных из супернатанта тупанвируса, по сравнению только с одним генотипом в супернатанте APMV (рис. 2b). Полосу, соответствующую каждому генотипу, обнаруженному в супернатанте тупанвируса, выделяли из 2% агарозного геля. Затем для каждой полосы было выполнено секвенирование по Сэнгеру, которое подтвердило наличие делеции (дополнительные данные 3).Та же процедура была проведена с гуарани, культивированным с APMV, и подтвердила присутствие генотипа дикого типа, но мутант не был обнаружен в этом состоянии.

    Рис. 2: Характеристика мутантного генотипа гуарани, выделенного из сокультуры тупанвируса.

    a Схематическое изображение коллагеноподобного гена у гуарани. Этот ген содержит пять коллагеноподобных повторов по 27 нуклеотидов каждый. Мутантный генотип показывает делецию 81 нуклеотидной последовательности, которая затрагивает четыре коллагеноподобных повтора, из которых два повтора полностью потеряны. b ПЦР-характеристика мутантного генотипа, обнаруженного в супернатанте тупанвируса, но не в сокультуре APMV. Здесь показан только продукт ПЦР, нацеленный на гуарани, выделенный из Tupanvirus Deep Ocean. Праймеры, используемые для этой системы ПЦР (Fw-del-OR8 и Rv-del-OR8), нацелены на области, расположенные вокруг сайта делеции. Затем генотип, соответствующий каждой полосе, подтверждали секвенированием по Сэнгеру.

    Эволюция мутантного вирофага и тупанвируса в ходе экспериментов с последовательным пассажем

    Адаптация вируса к новым хозяевам включает два этапа: во-первых, введение мутаций, позволяющих вирусу инфицировать новых хозяев, а затем поддержание этих мутаций во время распространения в популяции хозяев 25 .Имея это в виду, мы исследовали способность мутанта гуарани поддерживать делецию во время экспериментов с пассажем, используя Tupanvirus Deep Ocean в качестве хозяина вируса. Этот штамм тупанвируса был выбран потому, что он позволяет вирофагу реплицироваться с более высокой эффективностью репликации (рис. 1c, d). Мы непрерывно культивировали гуарани 5 раз в A. castellanii и впоследствии охарактеризовали его потомство после каждого пассажа с помощью нашей системы ПЦР, нацеленной на сайт делеции (рис. 3a, дополнительный рис.2). Этот эксперимент был начат с первичного культивирования гуарани дикого типа с тупанвирусом, за которым последовали четыре субкультуры. Каждый супернатант отбирали для выполнения нового пассажа через 48 часов в день. В это же время были собраны образцы для ПЦР, нацеленной на сайт делеции. Та же процедура была проведена для APMV и гуарани дикого типа (контроль) (рис. 3b, дополнительный рис. 2). Пассажи с тупанвирусом способствовали размножению мутантного генотипа, а не штамма дикого типа (рис. 3а). Очевидно, что по интенсивности продукта ПЦР после нескольких пассажей с тупанвирусом количество мутантной ДНК гуарани эволюционировало, чтобы уменьшаться (рис.3а). В контроле такого снижения не наблюдалось (рис. 3б). Эти результаты интригуют, учитывая высокую эффективность репликации мутантного генотипа, наблюдаемую с Tupanvirus Deep Ocean (рис. 1c). В то же время мы заметили прогрессирующее увеличение выживаемости популяции клеток-хозяев по прошествии пассажей. Такого увеличения не наблюдалось в контроле, в котором почти все клетки лизировались через 48 ч p.i. но в этих условиях количественная оценка этого параметра не проводилась. Эти наблюдения, вероятно, поднимают вопросы относительно вирулентности мутантного генотипа по отношению к его новому вирусному хозяину, тупанвирусу.Действительно, из нашего предыдущего исследования известно, что гуарани нарушает инфекционность своего вирусного хозяина APMV, что приводит к снижению лизиса амеб 14 . Следовательно, ингибирование тупанвируса может уменьшить размножение мутантного вирофага по пассажам. Кроме того, учитывая, что все супернатанты в этом эксперименте собирали при 48 часах в день, мы предполагаем, что потеря мутанта также может быть вызвана задержкой лизиса инфицированных им клеток. Это может предотвратить высвобождение вирофага для заражения свежих амеб во время пересева, и это явление усугубляется по мере того, как мы идем с пассажами, вызывающими разведение мутантов.Затем мы повторили тот же эксперимент, добавляя свежий тупанвирус в каждый пассаж (рис. 3c, дополнительный рис. 2). Мы обнаружили, что добавление свежего гигантского вируса позволяет размножаться и поддерживать мутантный гуарани. Эти результаты свидетельствуют о том, что делеция была основной, но, возможно, не исключительной детерминантой расширения диапазона хозяев гуарани. Это открытие также предполагает, что мутант гуарани может иметь отличный вирулентный профиль в отношении своего нового вируса-хозяина, чем генотип дикого типа в отношении APMV.Чтобы проверить эту гипотезу, мы сначала начали с изучения эволюции инфекционности тупанвируса во время эксперимента по пассажу в присутствии смеси, содержащей мутант гуарани. Используемый здесь гуарани был выделен из второй субкультуры с тупанвирусом, где явно наблюдалась делеция. Чтобы обеспечить размножение обоих вирусов, коинфицированные клетки наблюдали ежедневно, и каждый супернатант использовали для выполнения нового пассажа после полного лизиса амеб. В отсутствие полного лизиса клеток супернатанты собирали на 5-й день p.я. Полный лизис клеток наблюдали только в пассажах 1, 2 и 3. Затем в супернатанте во время пассажей наблюдали увеличение количества клеток, но этот параметр не был определен количественно в этом эксперименте. На рис. 3d показаны титры тупанвируса во время эксперимента с десятью пассажами в присутствии вирофага, измеренные методом конечного разведения. Перед конечным разведением супернатант вируса подвергали термообработке при 55 ° C в течение 30 мин. 26 . Эта обработка эффективно инактивировала вирофаг без снижения титра жизнеспособных гигантских вирусных частиц (дополнительный рис.3). Мы обнаружили, что заражение смесью, содержащей мутантный штамм, сильно изменяет траекторию тупанвируса в модели. Хотя было обнаружено, что вирус увеличивал свой титр при пассажах в отсутствие вирофага, присутствие последнего вызывало резкое снижение распространения вируса (рис. 3d). Более того, на девятом пассаже мы были заинтригованы отсутствием лизиса клеток и каким-либо очевидным цитопатическим действием на популяцию хозяина. Затем мы наблюдали за репликацией вирофага гуарани во время этого эксперимента с десятью пассажами.Процедуру также повторяли, добавляя свежий тупанвирус в каждый пассаж. При каждом пассаже репликацию гуарани оценивали с помощью ПЦР в реальном времени между инокуляцией супернатанта и лизисом амеб или 5 дней p.i. при отсутствии полного лизиса клеток. Результаты анализировали, как описано выше. Рисунок 3e убедительно подтверждает, что болезнь тупанвируса влияет на репликацию гуарани. Эта репликация снижалась до неопределяемого уровня, когда титр тупанвируса превышал предел менее 10 2 TCID 50 / мл.Даже при низких уровнях репликации вирофагов (P4 – P8) мы наблюдали дальнейшее снижение титра тупанвируса. Это предполагает, что низкоконцентрированный вирофаг может иметь более очевидный эффект на тупанвирус при низком титре. Наши результаты также показывают, что добавление свежего тупанвируса в систему сохраняет распространение вирофага (рис. 3e). Взятые вместе, эти наблюдения, вероятно, указывают на то, что мутация не только позволила гуарани реплицироваться с тупанвирусом, но и что мутантный вирофаг мог быть очень вирулентным до такой степени, что индуцировал уничтожение гигантского вируса в модели.

    Рис. 3. Отбор мутанта гуарани во время серийного пассажа в Tupanvirus Deep Ocean.

    a Отбор мутантного генотипа гуарани, коинфицирующего тупанвирус во время эксперимента с 5 пассажами, можно было визуализировать с помощью ПЦР (нижняя полоса-стрелка). b Поддержание проходных путей гуарани дикого типа с помощью APMV (контроль). c Тот же эксперимент в ( a ) повторяли, добавляя свежий тупанвирус с MOI 10 в каждый пассаж, показывая отбор и поддержание мутантных гуарани через пассажи. d Титр тупанвируса в течение 10 пассажей в присутствии и в отсутствие смеси, содержащей мутантный вирофаг, измеренный методом конечной точки (эксперимент проводили без добавления свежего гигантского вируса при каждом пассаже). и Гистограммы, изображающие репликацию генома тупанвируса, коинфицирующего гуарани, во время эксперимента с последовательным пассажем, выполняемого путем добавления и без добавления свежего гигантского вируса в каждый пассаж. Репликация ДНК вирофага между 0 часами п.и. и полный лизис амеб измеряли с помощью количественной ПЦР в реальном времени.В отсутствие полного лизиса клеток супернатанты отбирали через 5 дней p.i. Кратность индукции, соответствующая увеличению количества ДНК вирофага (представленного здесь), затем была рассчитана с использованием метода дельта Ct с учетом разницы между значениями Ct, специфичными для вирофага в момент времени H0 и во время лизиса клеток (или 5 дней пи при отсутствии полного лизиса амеб). В качестве отрицательного контроля использовали амебы, инфицированные только тупанвирусом. Все ПЦР, нацеленные на эти контроли, были отрицательными.Планки погрешностей, стандартное отклонение ( n = 3 биологически независимых эксперимента). Primo: Примо-сокультура дикого типа и TDO. Sub: Субокультура. П: Прохождение. TDO: Tupanvirus Deep Ocean. Н.Д .: Не обнаруживается.

    Инфекция вирофагов приводит к эрадикации тупанвируса

    Чтобы продолжить эту историю, мы стремились изучить влияние смеси вирофагов, содержащей мутант гуарани, на репликацию тупанвируса во время одноэтапной кривой роста. С этой целью клеток A. castellanii были коинфицированы смесью Tupanvirus Deep Ocean и гуарани, содержащей как дикий тип, так и мутантный генотип (согласно ПЦР), при MOI 10.Гуарани, использованный в этом исследовании, был выделен и затем очищен из второй субкультуры с тупанвирусом, в которой была обнаружена мутация. Сначала мы количественно оценили влияние вирофага на репликацию генома тупанвируса через 48 ч p.i. На рис. 4а показано, что присутствие мутанта гуарани снижает репликацию ДНК тупанвируса примерно в 3 раза. Эта низкая скорость ингибирования кажется относительно похожей на то, что было обнаружено между штаммом дикого типа и APMV 14 . Итак, вероятно, вирофаг подавляет распространение гигантского вируса в другой точке цикла, такой как морфогенез.Поэтому мы проверили влияние вирофага на продукцию жизнеспособных частиц, количественно определив титр тупанвируса от 0 до 72 часов p.i. Наши результаты показывают, что присутствие мутанта гуарани вызывает серьезное снижение инфекционности вирионов тупанвируса во время вирусного цикла (рис. 4b). Мы обнаружили, что в отсутствие вирофага гигантский вирус мог увеличивать свой титр до 500 раз во время одноступенчатой ​​кривой роста у амеб. Напротив, заражение смесью, содержащей мутантный генотип, предотвращало любое увеличение титра вируса.Это ингибирование (снижение в 1000 раз) намного выше, чем у APMV дикого типа (снижение в 10 раз) 14 . Тем не менее, через 72 часа p.i. мы все же смогли обнаружить продукцию инфекционных вирионов тупанвируса путем конечного разведения.

    Рис. 4. Характеристика биологической активности смеси, содержащей мутант гуарани, в цикле репликации тупанвируса Deep Ocean.

    a Репликация генома тупанвируса в присутствии и в отсутствие мутантного вирофага, измеренная с помощью количественной ПЦР в реальном времени.Метод Delta Ct был использован для анализа увеличения вирусной ДНК для каждого состояния между временами H0 и h58, как описано выше. Планки погрешностей, стандартное отклонение. b Одноступенчатая кривая роста тупанвируса в присутствии и в отсутствие мутанта гуарани, показывающая, что вирофаг резко снижает способность вируса продуцировать жизнеспособные вирионы у коинфицированных амеб. Небольшое увеличение титра тупанвируса наблюдалось с h22 до h42, что, вероятно, связано с усилением морфогенеза гигантских вирусных вирионов в клетках, коинфицированных гуарани дикого типа или инфицированных только тупанвирусом ( n = 3 биологически независимых эксперимента). c i Анализ с помощью просвечивающей электронной микроскопии показывает, что присутствие мутантного вирофага вызывает полное ингибирование морфогенеза тупанвируса. c Процент инфицированных амеб, у которых вирионы тупанвируса наблюдались в присутствии и в отсутствие мутантного вирофага. График c был создан путем анализа вирусных фабрик 200 коинфицированных клеток. Только амебы, у которых был обнаружен гуарани, были признаны пригодными для анализа на наличие тупанвируса.Планки погрешностей, стандартное отклонение. d i Изображения, полученные с помощью просвечивающей электронной микроскопии клеток A. castellanii , инфицированных тупанвирусом через 24 ч p.i. d При отсутствии инфекции вирофагами цитоплазма клетки заполнена зрелыми вирусными частицами. e i Присутствие мутанта гуарани полностью прерывает продукцию вирионов тупанвируса в коинфицированных клетках, в которых можно было наблюдать только потомство вирофагов ( i ).( g i ) показать одну и ту же ячейку с разными масштабами. TDO: Tupanvirus Deep Ocean. В.Ф .: Вирусная фабрика.

    Чтобы получить больше информации о взаимодействии вирофага и гигантского вируса, амебы были коинфицированы тупанвирусом Deep Ocean и смесью, содержащей мутант гуарани с MOI 10, и подготовили для просвечивающей электронной микроскопии (ПЭМ). Примечательно, что изображения ПЭМ показали, что присутствие мутанта гуарани вызывает полное ингибирование морфогенеза частиц тупанвируса (рис. 4c – i).Мы просканировали более двухсот клеток и количественно определили количество амеб, в которых наблюдались как вирофаги, так и потомство гигантского вируса (рис. 4c). Мы рассматривали только амеб, у которых был обнаружен гуарани, для анализа наличия тупанвируса. Наши результаты подтвердили отсутствие одновременного появления продукции вирионов гуарани и тупанвируса во всех коинфицированных клетках. Присутствие вирофага автоматически ассоциировалось с отсутствием вирионов тупанвируса (рис. 4d – i). Чтобы охарактеризовать это явление, мы наблюдали вирусные фабрики, инфицированные смесью, содержащей мутант гуарани, на последовательных стадиях коинфекции (рис.5). На рис. 5а показано, что через 16 ч p.i. вирус был способен продуцировать зрелые вирусные фабрики даже в присутствии вирофага. На этом этапе наблюдали первое потомство вирофага. Позже в цикле, через 20 часов, 24 часа, 30 часов и 36 часов p.i., соответственно, репликация вирофага прогрессивно увеличивалась и вызывала значительный ущерб вирусным фабрикам (рис. 5b-e). Последние казались распавшимися, и из каждой их части активно появлялось потомство вирофагов. Размножение вирофагов четко коррелировало с прогрессирующей деградацией вирусных фабрик тупанвируса.Выделение и характеристика этих структур ранее показали, что они состоят из арсенала кодируемых вирусом белков, участвующих в репликации и сборке вируса 27 . Следовательно, есть некоторое совпадение между нашими наблюдениями и предыдущими исследованиями, сообщающими, что вирофаги захватывают свой гигантский кодируемый вирусами механизм, чтобы экспрессировать и, вероятно, реплицировать свои геномы 28,29 . В этом исследовании мы предполагаем, что эти маленькие вирусы получают необходимые элементы с фабрик гигантских вирусов для размножения, вызывая их деградацию.

    Рис. 5: Репликация вирофага связана с прогрессирующей деградацией вирусных фабрик тупанвируса.

    Изображения, полученные с помощью просвечивающей электронной микроскопии вирусных фабрик тупанвируса, инфицированных смесью, содержащей мутант гуарани, на разных стадиях заражения. a Первое потомство вирофага можно было наблюдать через 16 часов в день. (стрелка), на данном этапе фабрики вирусов, кажется, еще не повреждены. b e Позже в цикле, в 20 ч, 24 ч, 30 ч и 36 ч р.i. соответственно, репликация вирофага (стрелки) вызывает заметную фрагментацию вирусных фабрик и, по-видимому, коррелирует с их прогрессирующей деградацией, влияя на морфогенез частиц тупанвируса.

    Однако до сих пор не ясно, как гигантский вирус смог продуцировать инфекционные вирионы в конце своего цикла (рис. 4b), несмотря на присутствие вирофага, который, как предполагается, вызывает его элиминацию. Поэтому мы количественно оценили количество инфицированных клеток для каждого вируса (тупанвирус и гуарани).Мы обнаружили, что все наблюдаемые клетки были успешно инфицированы тупанвирусом (100%). Хотя в присутствии вирофага не было произведено гигантских вирионов, присутствие их вулканически-подобной вирусной фабрики в цитоплазме данной клетки-хозяина считалось признаком заражения гигантским вирусом. С другой стороны, вирионы вирофагов наблюдались примерно в 76% хозяйских клеток (152 клетки из 200 наблюдаемых клеток). Это означает, что до 24% амеб были успешно инфицированы только тупанвирусом без вирофага.Два правдоподобных объяснения могут оправдать это наблюдение. Во-первых, используемая здесь суспензия вирофагов содержала как мутантные, так и генотипы дикого типа; таким образом, последний не мог реплицироваться в инфицированных им клетках. Во-вторых, титрование вирофага проводилось с помощью кПЦР, которая, в отличие от разведения конечной точки, нацелена как на инфекционные, так и на дефектные частицы. Основываясь на этих результатах, мы предполагаем, что гигантские вирусные частицы, образовавшиеся во время экспериментов с коинфекцией тупанвирусом и мутантным гуарани с MOI 10, были высвобождены из амеб, инфицированных только гигантским вирусом (и, вероятно, генотипом дикого типа).Поэтому мы снизили MOI тупанвируса с 0,01 до 1 и выполнили эксперимент «доза-реакция» для вирофага (рис. 6). Чтобы повысить частоту инфицирования вирофагом перед коинфекцией, вирофаг инкубировали с тупанвирусом в течение 30 минут при 30 ° C, чтобы обеспечить образование гигантского композита вирус-вирофаг. Действительно, считается, что вирофаги, подобные спутникам, проникают в их клетку-хозяина одновременно со своим ассоциированным гигантским вирусом, прикрепляясь к его капсидным фибриллам 30,31 . Рисунок 6c демонстрирует, что независимо от MOI тупанвируса более высокие концентрации вирофагов систематически снижали титр тупанвируса до неопределяемых уровней.Параллельно с этим результатом Замилон не смог вызвать такое ингибирование для тупанвируса (фиг. 6b), и в коинфицированных клетках наблюдали одновременную продукцию потомков вирофага и гигантского вируса (дополнительный рисунок 4). С другой стороны, хотя смесь, содержащая мутант гуарани, вызвала снижение титра APMV, увеличение MOI этого вирофага не смогло полностью предотвратить распространение вируса (фиг. 6a). Эти результаты подтверждают, что тупанвирус не смог создать продуктивную инфекцию в клетках-хозяевах, которые одновременно инфицированы мутантным генотипом гуарани.

    Рис. 6: Вирофаг останавливает распространение тупанвируса и защищает популяцию клеток-хозяев (амеб) от лизиса.

    a c Доза-реакция гигантского вируса на вирофаг. Клетки A. castellanii были коинфицированы APMV ( a ) или Tupanvirus Deep Ocean ( b , c ) при различных MOI (1, 0,1 и 0,01) и увеличивающихся MOI (0,1, 1 и 10) смесь вирофагов, содержащая мутант гуарани ( a , c ) или замилон ( b ).Затем измеряли титр тупанвируса в супернатанте путем конечного разведения после полного лизиса клеток или 5 дней p.i. при отсутствии лизиса клеток. c Более высокие концентрации вирофагов вызывают систематическое падение титра тупанвируса до неопределяемого уровня. Мы интерпретировали эти наблюдения как результат феномена выведения, вызванного вирофагом. Этот феномен не наблюдался ни при заражении тупанвирусом замилоном ( b ), ни при заражении APMV смесью вирофагов, содержащей мутант гуарани ( a ). d Анализ выживаемости клеток-хозяев в присутствии и в отсутствие мутантной инфекции гуарани. Клетки A. castellanii в среде PYG были коинфицированы тупанвирусом Deep Ocean при различных MOI (1, 0,1 и 0,01) и смесью вирофагов дикого типа и мутантного гуарани при MOI 10. Затем плотность клеток контролировали с помощью микроскопического подсчета из От 0 до 96 часов пи Незараженные амебы использовали в качестве контроля. В отсутствие вирофага, независимо от MOI тупанвируса, вирус лизирует всю популяцию клеток-хозяев за 96 ч.я. приблизительно. Присутствие вирофага резко изменяет лизис амеб при низких значениях MOI тупанвируса. Вирофаг защищает часть клеток-хозяев от лизиса при MOI 0,1 и 0,01 тупанвируса. При MOI 0,01 для тупанвируса фенотип популяции амеб кажется сходным с фенотипом неинфицированных клеток в присутствии мутанта гуарани. e Гистограммы, изображающие репликацию генома гуарани с тупанвирусом Deep Ocean при различных MOI (1, 0,1 и 0,01). Количественное определение ДНК проводили с помощью ПЦР в реальном времени и анализировали, как описано выше.Цифры в ( b d ) перечислены в соответствии с MOI тупанвируса. Планки погрешностей, стандартное отклонение (n = 3 биологически независимых эксперимента). Н.Д .: Не обнаруживается. TDO: Tupanvirus Deep Ocean.

    Популяция клеток-хозяев выживает после инфицирования тупанвирусом в присутствии мутантного вирофага

    Следующим шагом было исследование того, как мутант гуарани может влиять на стабильность популяции клеток-хозяев. Этот эффект был замечен во время экспериментов на рис.3, но не было точно определено количественно. С этой целью клеток A. castellanii в среде PYG (пептон, дрожжевой экстракт, глюкоза) одновременно инокулировали тупанвирусом с несколькими MOI (от 0,01 до 1) и смесью, содержащей мутант гуарани с более высоким MOI (MOI = 10). . Затем концентрацию популяции клеток-хозяев контролировали с помощью микроскопии от 0 до 96 часов p.i. В отсутствие гуарани инфекция тупанвирусом приводила к динамическому снижению плотности клеток до полного лизиса клеток примерно через 96 часов (рис.6г). Интересно, что при низких значениях MOI тупанвируса (0,1 и 0,01) коинфекция гуарани могла остановить распространение вируса и, таким образом, спасти популяцию клеток-хозяев от лизиса (рис. 6d). Даже в присутствии вирофага мы наблюдали цитопатический эффект (округлые клетки) и детектировали лизис клеток тупанвирусом при MOI, равном 1. Это открытие можно наблюдать, потому что инфекция тупанвирусом неизбежно вызывает лизис клеток, даже если вирионы не могут быть продуцированы. (Рис. 6c). Это наблюдение аналогично тому, что было описано для CroV 32 .Однако, снижая MOI вируса, мы наблюдали, что соседние клетки, по-видимому, не пострадали после лизиса инфицированных клеток, скорее всего, потому, что вирофаг был способен эффективно нейтрализовать вирус в коинфицированных клетках.

    Параллельно мы также количественно оценили репликацию гуарани на различных MOI тупанвируса. Рисунок 6e показывает, что репликация вирофага явно зависит от MOI тупанвируса. Мы обнаружили, что уменьшение MOI гигантского вируса нарушает репликацию гуарани. Это может быть связано с низким количеством коинфицированных амеб, но также с отсутствием распространения тупанвируса в присутствии гуарани.

    Анализ приспособленности мутантов гуарани к гигантским вирусам, принадлежащим к трем филогенетическим линиям семейства

    Mimiviridae

    Затем мы проанализировали, было ли приобретение гуарани хозяином связано с компромиссом пригодности с прототипом изолята рода Mimivirus , APMV, который ранее использовался для размножения генотипа гуарани 14,33 дикого типа. Действительно, экспериментальные исследования эволюции других вирусов показали, что повышение приспособленности вируса у одного хозяина может привести к ухудшению приспособленности у другого хозяина 1 .Мы сравнили эффективность репликации гуарани до и после его пассажей с тупанвирусом, используя APMV в качестве гигантского вирусного хозяина. Здесь исследовалась только пригодность гуарани, выделенного из тупанвируса Deep Ocean, потому что этот вирофаг был единственным, который был хорошо охарактеризован и обогащен проходами. Используемый здесь мутант был выделен после четырех суб-сокультивов с тупанвирусом (рис. 3а) и имеет такую ​​же делецию в ORF 8, что и мутация в ее геноме. Рисунок 7 показывает, что даже после приобретения новых вирусных хозяев вирофаг сохранял свою способность реплицироваться с APMV.Кроме того, эффективность репликации гуарани, выделенного из супернатанта тупанвируса с APMV, была аналогична эффективности репликации исходного штамма гуарани, размноженного с APMV (тест Стьюдента t , p > 0,67). Аналогичные результаты были получены с Moumouvirus и Megavirus Courdo 11, которые являются мимивирусами из линий B и C, соответственно 34,35 . Мы также заметили, что приспособленность мутанта гуарани к тупанвирусу, по-видимому, значительно выше, чем его репликация с APMV или чем у дикого типа с этим гигантским вирусом (рис.1c, d, рис. 7) (тест Стьюдента t , p <0,0005). Можно предположить, что это может быть связано с адаптацией аппарата транскрипции тупанвируса к мутантному геному гуарани. Однако только обширный биоинформатический анализ может подтвердить эту гипотезу и предоставить дальнейшие объяснения.

    Рис. 7: Сравнительный анализ приспособленности мутантов гуарани к гигантским вирусам из трех филогенетических клад семейства Mimiviridae .

    График, изображающий репликацию генома гуарани, выделенного из субокультуры 4 с супернатантами APMV (1) или Tupanvirus Deep Ocean (2) с различными мимивирусами, принадлежащими к трем филогенетическим линиям A, B и C.Репликация ДНК вирофага при 0 и 48 часах в день. измеряли количественной ПЦР в реальном времени. Затем рассчитывали увеличение количества ДНК вирофага (кратность индукции) с использованием метода дельта Ct с учетом разницы между значением Ct, специфичным для вирофага, в моменты времени H0 и h58. В качестве отрицательного контроля использовали амебы, инфицированные только каждым гигантским вирусом. Все ПЦР, нацеленные на эти контроли, были отрицательными при временах H0 и h58. Планки погрешностей, стандартное отклонение ( n = 3 биологически независимых эксперимента).

    Индуцированное тупанвирусом отключение рибосомы хозяина предотвращает инфицирование вирофагом

    Тупанвирус способен запускать цитотоксический профиль, связанный с отключением рибосомной РНК (рРНК) в организмах-хозяевах и нехозяевах 16 . Этот профиль, вероятно, позволяет вирусу модулировать организмы, не являющиеся хищниками, чтобы увеличить шансы вируса на выживание в природе. У организмов-хозяев, таких как A. castellanii , это явление в основном наблюдается при высоких MOI, таких как MOI 100. В этих условиях вирус вызывает цитотоксичность своей клетки-хозяина без репликации 16 .Здесь мы исследовали, как эта цитотоксичность может модулировать паразитизм вирофагов и, в частности, инфицирование мутантным генотипом гуарани. Насколько нам известно, такое исследование никогда не проводилось. A. castellanii клетки были коинфицированы тупанвирусом при MOI 100 и каждым вирофагом (Sputnik, Zamilon или смесь, содержащая мутант гуарани) при MOI 10. Мумувирус, мимивирус линии B, использовался в качестве контроля, поскольку он позволяет репликация всех вирофагов, использованных в этом исследовании.Сначала при 9 часах в день было собрано 5 × 10 5 клеток, чтобы проверить влияние гуарани на отключение рибосом. Мы обнаружили, что в отличие от контроля, независимо от присутствия мутанта гуарани, тупанвирус был способен вызывать серьезную остановку в изобилии рибосомальной РНК хозяина (рис. 8а). Затем мы измерили репликацию каждого вирофага с помощью кПЦР и вычислили увеличение количества их ДНК, используя метод дельта Ct, учитывая времена 0 и 48 p.i. Все вирофаги были способны реплицироваться с мумувирусом при MOI 100 (рис.8б). Напротив, все вирофаги, включая гуарани, не смогли заразить тупанвирус при высоком MOI (рис. 8c). Эти результаты предполагают, что цитотоксический профиль тупанвируса позволил ему избежать заражения вирофагами и, в частности, искоренения, которое могло быть вызвано гуарани.

    Рис. 8: Инфекция вирофагов и отключение рРНК, вызванное тупанвирусом.

    Клетки A. castellanii были коинфицированы тупанвирусом Deep Ocean с MOI 100 и каждым вирофагом с MOI 10. a Гель для электрофореза, показывающий профиль рибосомной РНК (18S и 28S) из A. castellanii в присутствии и в отсутствие гуарани. Мумувирус использовался в качестве гигантского средства борьбы с вирусом. Тупанвирус заметно вызывал серьезное отключение рРНК даже в присутствии вирофага. b Все вирофаги реплицируются с Moumouvirus при MOI 100. c Все вирофаги не реплицируются в амебах, коинфицированных тупанвирусом, при MOI 100. Планки ошибок, стандартное отклонение ( n = 3 биологически независимых эксперимента).TDO: Tupanvirus Deep Ocean.

    Вирус мозаики томатов и вирус табачной мозаики

    Краткая информация

    • Вирус мозаики томата (ToMV) и вирус мозаики табака (TMV) трудно различить.
    • Вирус мозаики томатов (ToMV) может вызывать пожелтение и задержку роста томатов, что приводит к потере древостоя и снижению урожайности.
    • ToMV может вызвать неравномерное созревание плодов, что еще больше снижает урожайность.
    • Вирус табачной мозаики (TMV) когда-то считался более распространенным на помидорах.
    • TMV обычно является скорее патогеном табака, чем томатом.

    Хозяин и возбудитель

    ToMV чаще всего поражает помидоры, но вирус также может инфицировать перец, картофель, яблоко, грушу, вишню и многочисленные сорняки, включая поросенок и четвертины ягненка.

    Симптомы могут отличаться на разных хостах. TMV имеет очень широкий спектр хозяев, поражая многие сельскохозяйственные культуры, декоративные растения и сорняки, включая огурцы, салат, свеклу, перец, томаты, петунию, дурман и хрящевик.

    Признаки и симптомы

    Зеленый и желтый мозаичный узор на листе, инфицированном TMV

    В целом, симптомы вируса мозаики томатов могут быть разнообразными, и их трудно отличить от других распространенных вирусов томатов. Окончательный диагноз можно поставить, отправив образец в клинику болезней растений Университета Миннесоты.

    • Пятнистые светло-темно-зеленые на листьях.

      Симптомы вируса табачной мозаики на рассаде томата

    • Если растения заражены рано, они могут стать желтыми и в целом низкорослыми.
    • Листья могут быть скрученными, деформированными или уменьшенными в размере.
    • При высоких температурах у некоторых сортов могут появиться пятна отмершей ткани листьев.
    • Плоды могут созревать неравномерно.
    • Уменьшенное количество и размер плодов.
    • Желтоватые кольца могут образовываться, если плоды созревают в теплую погоду.
    • Плоды могут иметь внутреннее потемнение под кожицей (коричневая стенка).

    Окружающая среда

    • Симптомы могут быть подавлены при низких температурах.В результате зараженные сеянцы могут не проявлять симптомов, пока их не переместят в теплую среду.

    Биология и цикл болезней

    Вирус мозаики томатов и вирус табачной мозаики могут существовать в течение двух лет в сухой почве или остатках листьев, но сохранятся только в течение одного месяца, если почва влажная. Вирусы также могут выжить в инфицированных остатках корней в почве до двух лет.

    Семена могут быть инфицированы и передать вирус растению, но болезнь обычно заносится и распространяется главным образом в результате деятельности человека.Вирус может легко распространяться между растениями по рукам, инструментам и одежде рабочих при обычных действиях, таких как завязывание растений, удаление присосок и сбор урожая.

    Вирус может выжить даже в процессе отверждения табака и может распространяться от сигарет и других табачных изделий на растительный материал, с которым рабочие работают после выкуривания сигареты. Правильное мытье рук и стерилизация инструментов и оборудования необходимы для предотвращения распространения этого заболевания.

    Попав внутрь растения, вирус размножается, вызывая описанные выше симптомы.

    Менеджмент

    Устойчивые сорта

    Существует множество разновидностей томатов, устойчивых к тому или иному вирусу. Они обычно обозначаются в каталогах семян, часто с кодом ToMV после названия сорта, если они устойчивы к вирусу мозаики томатов, и TMV, если они устойчивы к вирусу табачной мозаики. Лишь несколько разновидностей устойчивы к обоим вирусам.

    Некоторые популярные подвои для привитых томатов также могут придавать устойчивость сортам, которые обычно не обладают устойчивостью.

    Сорта томатов, устойчивые к ToMV и TMV
    Устойчивость к ToMV ВТМ-резистентный Устойчив к обоим Устойчивый подвой
    Больсено Большая говядина БХН-444 Эстамино (ToMV)
    Tomimaru Muchoo Знаменитости Здоровый удар DRO138TX (ToMV)
    Розовое чудо BHN-871 Софья Колосс (TMV)
    Беоранж Клермон Талладега Максифорт (TMV)
    Поццано Geronimo Сверхъестественное (TMV)
    Санпич Сунгольд РСТ-04-105-Т (ТМВ)

    Более обширный список устойчивых сортов томатов можно найти на сайте Vegetable MD Online Корнельского университета.

    Культурный контроль

    • Используйте сертифицированные семена, не содержащие болезней, или обработайте собственные семена.
      • Замочите семена в 10% растворе тринатрийфосфата (Na 3 PO 4 ) как минимум на 15 минут.
      • Или нагрейте сухие семена до 158 ° F и держите их при этой температуре от двух до четырех дней.
    • Приобретайте трансплантаты только из проверенных источников. Спросите о санитарных процедурах, которые они используют для предотвращения болезней.
    • Осмотрите трансплантаты перед покупкой.Выбирайте только трансплантаты без явных симптомов.
    • Избегайте посадки на полях, где есть остатки корней томатов, поскольку вирус может долго сохраняться в корнях.
    • Мойте руки водой с мылом до и во время работы с растениями, чтобы уменьшить возможное распространение между растениями.
    • Регулярно дезинфицируйте инструменты — в идеале между каждым растением, так как растения могут быть заражены до того, как проявятся явные симптомы.
      • Замачивание инструментов в течение 1 минуты в бактерицидном отбеливателе 1: 9 очень эффективно.
      • Или 1-минутное замачивание в растворе обезжиренного сухого молока и воды с концентрацией 20% по объему, также очень эффективно.
      • При обрезке растений используйте два секатора и чередуйте их, чтобы обеспечить необходимое время замачивания между растениями.
    • Избегайте использования табачных изделий вокруг растений томатов и мойте руки после употребления табачных изделий и перед работой с растениями.
      • Табак в сигаретах и ​​других табачных изделиях может быть инфицирован ToMV или TMV, оба из которых могут передаваться на растения томатов.
    • Разведайте заводы регулярно. Если обнаружены растения с симптомами ToMV или TMV, удалите все растение (включая корни), поместите его в пакет и отправьте в Клинику диагностики растений Университета Миннесоты для диагностики.
    • Если ToMV или TMV подтверждены, используйте строгие санитарные процедуры, чтобы уменьшить распространение на другие растения, поля, туннели и теплицы.
      • Зараженные растения полностью вырвать и сжечь. Не компостируйте зараженный растительный материал.
      • После работы с больными растениями тщательно продезинфицируйте все инструменты и руки, как описано выше.
      • Для дополнительной защиты от распространения храните отдельные инструменты для работы в больной зоне и избегайте работы со здоровыми растениями после работы в зоне с больными растениями.
      • В конце сезона сожгите все растения с пораженных участков, даже если они выглядят здоровыми, или закопайте их подальше от участков выращивания овощей.
      • Дезинфицируйте колья, стяжки, проволоку или любое другое оборудование в период между вегетационными периодами, используя методы, указанные выше.

    Химический контроль

    В настоящее время не существует химических вариантов, эффективных против любого вируса.

    Анна Джонсон; Мишель Грабовски, педагог-консультант, и Анжела Оршински, патолог-консультант

    6 лучших типов веб-хостинга, которые следует рассмотреть в 2021 году

    Хотите сразу перейти к ответу? Вот 6 типов планов хостинга, которые следует учитывать, и лучший веб-хостинг для каждого:

    Тип веб-хостинга, который вы выбираете, является невероятно важным выбором для того, какой тип веб-сайта вы создаете.

    Если вы запускаете свой первый веб-сайт, вам следует узнать о различных типах веб-хостинга. Таким образом вы сможете определить, какой вариант лучше всего подходит для вашего сайта.

    Не торопитесь с этим процессом. Выбор неправильного типа веб-хостинга может вызвать большие проблемы для вашего сайта в будущем.

    Некоторые из вас могут быть недовольны текущей ситуацией с веб-хостингом, поэтому вы хотите переключиться на другой тип. Вот что привело вас на эту страницу.

    Независимо от вашей ситуации, это руководство объяснит все, что вам нужно знать о вариантах вашего веб-хостинга.Как только вы определитесь с типом веб-хостинга, который вам нужен, вы сможете просмотреть лучших провайдеров веб-хостинга и выбрать план, соответствующий вашим потребностям.

    Что такое веб-хостинг?

    Давайте рассмотрим основы, чтобы убедиться, что вы в первую очередь полностью понимаете, что такое веб-хостинг.

    Веб-сайты размещаются на серверах, которые представляют собой мощное оборудование, на котором размещаются веб-сайты и данные, связанные с этими сайтами. Каждый компонент вашего веб-сайта хранится на сервере и доступен через ваш веб-хостинг.Сюда входят такие элементы, как файлы, текст, изображения, видео — все.

    Серверы

    физически расположены в центрах обработки данных, которые обычно обслуживаются и управляются различными компаниями, предоставляющими веб-хостинг.

    Веб-хосты

    предоставляют технологии и пространство на сервере, необходимые для доступа к вашему веб-сайту в Интернете. Это позволяет пользователям искать ваш сайт и просматривать ваши веб-страницы в Интернете.

    Различные типы веб-хостинга

    Все сервера разные. Вот почему существуют разные варианты веб-хостинга.

    Несколько веб-сайтов могут использовать один сервер. Между тем у некоторых веб-сайтов есть собственный сервер.

    Существует четыре основных типа веб-хостинга:

    Хостинг для реселлеров

    и хостинг WordPress также относятся к этим категориям. В дальнейшем мы рассмотрим все шесть типов веб-хостинга.

    Как узнать, какой вариант хостинга лучше всего подходит для вашего сайта?

    Тип сервера, который вы выбираете, влияет на такие элементы, как производительность, безопасность, масштабируемость и уровень управления вашим сайтом.

    Ваше решение также зависит от типа вашего веб-сайта и объема трафика, который вы получаете.

    Например, небольшой личный блог с 5000 посетителей в месяц имеет другие потребности в хостинге, чем большой сайт электронной коммерции с 250 000 посещений в месяц.

    Также стоит отметить, что разные варианты хостинга предлагаются по разным ценам. Поэтому важно, чтобы вы нашли вариант, который также укладывается в ваш бюджет.

    Я выделил и объяснил шесть различных вариантов веб-хостинга ниже.Вы можете использовать эту информацию, чтобы выяснить, какой тип хостинга лучше всего подходит для вашего сайта.

    Виртуальный хостинг

    Виртуальный хостинг — это самый простой тип веб-хостинга. Это рентабельный и лучший выбор для небольших веб-сайтов или сайтов начального уровня.

    Как следует из названия, веб-сайты, использующие общий хостинг, будут совместно использовать ресурсы с другими веб-сайтами на одном сервере.

    Вот почему виртуальный хостинг остается таким дешевым. Разделение ресурсов снижает затраты веб-хостинга.

    Таким образом, каждый веб-сайт на сервере будет иметь ограниченное количество ресурсов, как определено их конкретным планом хостинга.

    Думайте об этом как об аренде квартиры с соседями по комнате. У вас есть собственная спальня, но вы и ваши соседи по комнате будете использовать общие ресурсы, такие как вода, электричество и общие помещения по всему дому.

    Природа совместного использования сервера с другими веб-сайтами имеет свои недостатки. Если на другом веб-сайте на вашем сервере наблюдается всплеск трафика, это потенциально может вызвать проблемы с производительностью вашего сайта.Эти ситуации находятся вне вашего контроля.

    Таким образом, хотя виртуальный хостинг — отличный вариант, если вы хотите немного сэкономить, он определенно не предоставит вам и посетителям вашего сайта самого качественного веб-хостинга.

    Для кого виртуальный хостинг?

    Виртуальный хостинг — отличный выбор для начинающих и небольших сайтов. Это рентабельно и не требует больших технических знаний, чтобы начать работу.

    Я бы порекомендовал общий веб-хостинг веб-сайтам с ограниченным бюджетом.Блогеры и владельцы малого бизнеса, у которых есть простые веб-сайты, являются отличными кандидатами на виртуальный хостинг. Этот тип хостинга подойдет для любого веб-сайта, который не требует слишком много взаимодействия на сайте или большого количества ресурсов.

    Если вы не ожидаете более 10 000 или 20 000 посещений вашего веб-сайта в месяц, вы можете сэкономить деньги, выбрав план общего веб-хостинга.

    Плюсы общего веб-хостинга:

    • Самый экономичный вид веб-хостинга.
    • Простота установки.
    • Никаких технических знаний не требуется.
    • Отлично подходит для начинающих и небольших сайтов.

    Минусы общего веб-хостинга:

    • Совместное использование ресурсов сервера с другими веб-сайтами.
    • Проблемы с производительностью находятся вне вашего контроля.
    • Более медленное время загрузки и меньшее время безотказной работы.
    • Не масштабируется.

    Лучший провайдер общего веб-хостинга — Bluehost

    Наша рекомендация для виртуального хостинга — Bluehost.Так что, если вам кажется, что виртуальный хостинг — лучший вариант для вашего сайта, это наиболее логичное место для начала поиска.

    Этот провайдер имеет выдающуюся репутацию в отрасли. Более 2 миллионов веб-сайтов по всему миру доверяют Bluehost в качестве веб-хостинга.

    Bluehost предлагает планы общего хостинга от 2,95 долларов в месяц.

    Все планы включают бесплатный домен, бесплатный сертификат SSL и бесплатные маркетинговые кредиты для Google Ads и Microsoft Advertising.

    Если у вас есть вопросы, проблемы или вам нужна помощь, вы можете связаться со службой поддержки Bluehost 24/7 по телефону или в чате.

    Хостинг VPS

    VPS означает «виртуальный частный сервер». Этот тип хостинга является ступенью выше общего веб-хостинга. Когда веб-сайт перерастает свой общий тарифный план, владельцы часто переходят на VPS.

    С виртуальным частным сервером ваш веб-сайт по-прежнему будет использовать один сервер с другими веб-сайтами. Однако количество веб-сайтов, которыми вы будете делиться, значительно меньше.

    Главный сервер разделен на несколько виртуальных серверов — отсюда и название. Эти виртуальные серверы могут быть настроены для отдельных веб-сайтов.

    Несмотря на то, что главный сервер используется совместно с другими сайтами, на вашем сайте будут выделенные ресурсы с VPS.

    Для тех из вас, кто хочет запускать собственные конфигурации на своем сервере, вы можете получить дополнительный root-доступ с вашим планом хостинга VPS.

    Ваш сайт будет в целом работать лучше, так как вы не делитесь ресурсами.Это означает, что вы выиграете от более быстрой загрузки и увеличения времени безотказной работы. Вам не нужно беспокоиться о другом веб-сайте, который может вызвать сбой вашего сайта.

    Большинству веб-сайтов не нужен выделенный сервер (мы поговорим об этом позже). Но VPS дает вам некоторые преимущества выделенного хостинга за небольшую плату.

    Виртуальный частный сервер — это как самостоятельная аренда квартиры. Вы не будете делить кухню, ванную комнату, гостиную или другие общие помещения с соседями по комнате.Это дает вам гораздо больше свободы и гибкости, чтобы делать с пространством то, что вы хотите.

    Однако вы будете делиться некоторыми ресурсами с другими юнитами в здании. Так что некоторые ограничения все равно будут.

    Для кого предназначен VPS-хостинг?

    Хостинг

    VPS лучше всего подходит для малых и средних предприятий, которые не могут позволить себе неожиданные простои на своем веб-сайте. Это отличный вариант для владельцев веб-сайтов, которые переросли ресурсы плана общего хостинга.

    Виртуальный частный сервер может быть полезен владельцам веб-сайтов, которые технически подкованы и хотят вносить индивидуальные изменения в конфигурацию своего сервера.

    Сайты с большими файлами, такими как видео и изображения, должны использовать VPS. Интерактивные веб-сайты со сложными файлами будут работать лучше на VPS, чем на общем сервере.

    Плюсы хостинга VPS:

    • Ресурсы выделенного сервера.
    • Возможность делать индивидуальные конфигурации для вашего сервера.
    • Более высокая продолжительность безотказной работы и более высокая скорость загрузки.
    • Экономичнее, чем выделенный сервер.

    Минусы хостинга VPS:

    • Совместное использование основного сервера с другими веб-сайтами.
    • Не так просто настроить, как общий сервер.
    • По-прежнему имеет ограничения в отношении того, что вы можете контролировать.

    Лучший провайдер хостинга VPS — InMotion

    Многие хостинг-провайдеры предлагают планы VPS, но InMotion — наша лучшая рекомендация для этого типа веб-хостинга.

    Планы VPS, предлагаемые InMotion, имеют root-доступ, что дает вам возможность вносить индивидуальные изменения в ваш виртуальный сервер. Это отличный вариант для тех из вас, кто более продвинут в техническом плане.

    InMotion предлагает бесплатные cPanel и WHM, что упрощает просмотр и управление своим VPS для всех.

    У вас также будет возможность выбрать центр обработки данных для максимальной скорости. InMotion имеет планы VPS, которые также оптимизированы для интернет-магазинов.

    Все планы VPS от InMotion имеют 90-дневное обещание возврата денег, что является одной из лучших гарантий удовлетворения, которые вы найдете в отрасли.

    Хостинг WordPress

    Хостинг

    WordPress оптимизирован для WordPress в качестве вашей системы управления контентом.

    Обычно вы видите два разных типа хостинга WordPress, предлагаемых провайдерами.

    • Общий хостинг WordPress
    • Управляемый хостинг WordPress

    Общий хостинг WordPress работает так же, как и обычный общий хостинг, за исключением того, что WordPress может быть предварительно установлен.

    Управляемый хостинг WordPress предоставляет дополнительные преимущества, такие как повышенная безопасность, кеширование сервера, промежуточное хранение и более высокая скорость загрузки.

    Лучшие планы хостинга WordPress также включают установку WordPress в один клик.

    Хостинг

    WordPress обычно имеет дополнительную безопасность, специально разработанную для веб-сайтов, работающих на WordPress. Поскольку WordPress является наиболее часто используемой CMS в мире, эти веб-сайты подвержены более высокому риску киберпреступности. Так что дополнительная безопасность определенно является большим преимуществом.

    Для кого хостинг WordPress?

    Это не ракетостроение. Хостинг WordPress предназначен для пользователей WordPress. Если вы хотите, чтобы ваш хостинг был оптимизирован для вашего сайта WordPress, вам следует изучить этот тип веб-хостинга.

    Плюсы хостинга WordPress:

    • Оптимизировано для WordPress.
    • WordPress предустановлен или устанавливается в один клик.
    • Повышенная безопасность для сайтов WordPress.

    Минусы хостинга WordPress:

    • Меньше контроля и гибкости.
    • Обновления не всегда проходят гладко.
    • Совместное использование ресурсов с другими сайтами WordPress.

    Лучший хостинг-провайдер WordPress — WP Engine

    Я должен начать с того, что немного предвзято отношусь к этому вопросу.Мы используем WP Engine здесь, в Quick Sprout, поэтому, естественно, это мой лучший выбор в этой категории.

    Это не обязательно лучший выбор для новичков. Но для тех из вас, кто имеет некоторый опыт работы с веб-хостингом и планирует создать блог или бизнес-сайт с высоким трафиком, WP Engine — ваш лучший выбор.

    У

    WP Engine есть планы хостинга WordPress от 30 долларов в месяц. Это еще одна причина, по которой я не думаю, что это лучший выбор для новичка. Существуют и другие планы хостинга WordPress по цене менее 5 или 10 долларов в месяц.

    Скорость и безопасность — лучшая часть WP Engine. Они предлагают услуги управляемого хостинга WordPress, поэтому все обрабатывается на уровне сервера.

    Это означает, что вам не придется устанавливать множество дополнительных плагинов, которые могут утяжелить ваш сайт.

    Еще одна причина, по которой я рекомендую WP Engine, заключается в том, что у них отличная поддержка клиентов. Все планы поставляются с круглосуточным живым чатом, а некоторые из планов более высокого уровня даже с круглосуточной поддержкой по телефону.

    Я был впечатлен качеством и уровнем обслуживания, когда мне приходилось обращаться к ним.

    Выделенный хостинг

    Выделенные серверы обычно считаются лучшим выбором для веб-хостинга. Это потому, что у вас есть выделенный сервер, который принадлежит вам, и только вам. Вы также обычно получаете больше преимуществ с выделенным хостингом, такими как большее время безотказной работы и более высокая скорость.

    Однако здесь есть одна загвоздка: это самый дорогой тип веб-хостинга.

    Поскольку вы не будете делиться ресурсами или чем-либо еще с другими веб-сайтами, ваш сайт будет работать с максимальной производительностью.

    Сайты, размещенные на выделенном сервере, имеют полный технический контроль над настройками сервера. Вы выбираете программное обеспечение, конфигурации и все, что вам нужно.

    Если вы приобретете выделенный сервер, вы должны ожидать чрезвычайно высокой продолжительности работы и молниеносной скорости загрузки. Вам не нужно беспокоиться о том, что трафик с других сайтов повлияет на вашу эффективность.

    Выделенный сервер — это как владение домом. Если вы хотите построить забор, посадить дерево во дворе, построить патио или отремонтировать кухню, все полностью зависит от вас.

    Для кого предназначен выделенный хостинг?

    Тарифы на выделенный хостинг обычно зарезервированы для веб-сайтов корпоративного уровня. Это означает более 100 000 посещений в месяц — не говоря уже о больших доходах, которые можно получить, чтобы позволить себе сервер.

    Даже не рассматривайте этот тип хостинга, если вам все еще трудно привлечь несколько тысяч трафика в месяц.

    Крупные сайты электронной коммерции и предприятия должны рассмотреть вариант выделенного хостинга, потому что они могут полностью контролировать функции своего сервера.Сайты, требующие высочайшего уровня безопасности, например веб-сайты, на которых хранятся финансовые данные или медицинская информация, выиграют от использования выделенного сервера.

    Выделенные серверы имеют разные уровни управления. Вы можете найти хостинг-провайдера, который будет управлять вашим сервером за вас, или вы можете управлять им самостоятельно. Обратной стороной самостоятельного управления сервером является то, что вы будете нести ответственность за установку обновлений и мониторинг всего на предмет сбоев и ошибок.

    Рассматривайте выделенный сервер только в том случае, если вы можете себе это позволить.В большинстве случаев план выделенного хостинга не входит в ваш ценовой диапазон, особенно если вы запускаете новый веб-сайт. Эти серверы могут стоить до 2000 долларов в месяц.

    Профи выделенного хостинга:

    • Полный контроль над сервером.
    • Не делиться ресурсами с другими веб-сайтами.
    • Высокая безопасность.
    • Быстрая загрузка, высокое время безотказной работы и оптимальная производительность.

    Минусы выделенного хостинга:

    • Самый дорогой вид веб-хостинга.
    • Требуются технические знания.
    • Вы за все несете ответственность.

    Лучший провайдер выделенного хостинга — HostGator

    HostGator — моя главная рекомендация для тарифных планов выделенного сервера. Хотя выделенный хостинг определенно не из дешевых, планы, предлагаемые HostGator, на самом деле довольно доступны.

    Начальные цены на их выделенные серверы начинаются от 118,99 долларов в месяц.

    Одна из причин, по которой мне нравится HostGator, заключается в том, что они предлагают полностью управляемые планы.Если вы хотите, их команда технических специалистов может заняться мониторингом системы, установкой исправлений программного обеспечения, обновлениями, удаленным резервным копированием, миграцией данных и т. Д.

    У вас также будет доступ к приоритетной поддержке клиентов 24/7/365.

    Итак, если вы считаете, что вашему веб-сайту нужен выделенный сервер, ознакомьтесь с планами и вариантами, предлагаемыми SiteGround.

    Облачный хостинг

    Облачный хостинг похож на гибридную версию VPS, но более экономичен.

    Планы облачного хостинга

    включают несколько удаленных серверов.У каждого сервера разные обязанности. Если один из серверов скомпрометирован или имеет проблему, другие серверы в сети возьмут на себя эти обязанности и возьмут на себя слабину.

    Вот что делает облачный веб-хостинг такой привлекательной альтернативой традиционному веб-хостингу.

    С облачными серверами у вашего веб-сайта будет больше времени безотказной работы и меньше непредвиденных простоев из-за ошибок сервера. Ваш сайт останется подвижным и будет работать на высоком уровне.

    Самое лучшее в облачном веб-хостинге — это масштабируемость.

    При традиционном хостинге всегда существует постоянная дилемма между ресурсами сервера и ценой. Вы не хотите переплачивать за план с ресурсами, которые вы никогда не будете использовать, но в то же время вы не хотите превышать ресурсы меньшего плана и отрицательно влиять на производительность вашего веб-сайта.

    Если вы точно не знаете, сколько просмотров страниц ваш сайт будет получать в месяц, это практически невозможно предсказать.

    Но посещаемость сайта никогда не является точной наукой. Время от времени вы будете испытывать резкие скачки или скачки посещаемости вашего сайта, и это отличная новость. Вам просто нужно убедиться, что ваш план учитывает этот трафик.

    Вот почему облачный хостинг — лучшее решение этой дилеммы. Лучшие планы облачного хостинга позволяют масштабировать ресурсы по запросу.

    Вы платите за то, что используете, и всегда можете настроить эти ресурсы на панели администратора.

    Для кого облачный хостинг?

    Облачный хостинг — лучший вариант для быстрорастущих веб-сайтов среднего и крупного бизнеса.

    Если посещаемость вашего веб-сайта непредсказуема и вы планируете его стабильное масштабирование в ближайшие месяцы или годы, вам следует подумать о плане облачного хостинга.

    Любой веб-сайт с более чем 50 000 посещений страниц в месяц может рассмотреть вариант облачного решения. Веб-сайты, которые выросли из общего плана и нуждаются в обновлении, могут искать облачный хостинг в качестве альтернативы VPS.

    Плюсы облачного хостинга:

    • Высокая безопасность.
    • Масштабируйте ресурсы по запросу.
    • Меньше непредвиденных простоев.

    Минусы облачного хостинга:

    • Цены не всегда фиксированы.
    • Непредсказуемый трафик может увеличить расходы.
    • Ограниченная настройка.

    Лучший провайдер облачного хостинга — SiteGround

    Если вы заинтересованы в облачном хостинге, не ищите ничего, кроме SiteGround. Siteground всегда был лидером в области веб-хостинга. Их облачные планы подходят для самых разных предприятий и веб-сайтов различного размера.

    Их облачные планы начального уровня включают 2 ядра ЦП, 4 ГБ памяти и 40 ГБ места на SSD. Но вы можете полностью настроить облако, содержащее до 32 ядер ЦП, 128 ГБ памяти и 1 ТБ места на твердотельном накопителе. Хотя большинству из вас все это не понадобится, приятно знать, что у вас есть эти настраиваемые параметры, чтобы предоставить именно то, что требуется вашему веб-сайту.

    Облачные планы

    SiteGround полностью управляются. Их ИТ-команда позаботится обо всех технических аспектах вашего хостинга.Это позволяет сосредоточиться на всем остальном.

    Все облачные планы включают бесплатный SSL, бесплатный CDN, частный DNS и ежедневное резервное копирование. Если вам когда-нибудь понадобится помощь, вам также будет доступна расширенная приоритетная поддержка SiteGround.

    Реселлерский хостинг

    Реселлерский хостинг подразумевает продажу клиентам услуг хостинга. Таким образом, это определенно не для всех. Если вы создаете небольшой веб-сайт с нуля или просто хотите разместить его самостоятельно, вам стоит поискать в другом месте.

    Но если вы хотите продавать веб-хостинг другим сайтам, вам следует изучить планы хостинга для реселлеров.

    Реселлерский хостинг — это в основном веб-хостинг white label. Вы покупаете хостинг у провайдера, а затем перепродаете эти услуги своим клиентам.

    Как торговый посредник, вы можете выбирать варианты ценообразования для своих клиентов. Поскольку вы будете платить поставщику по оптовым ценам, у вас есть возможность получить значительную прибыль.

    Для кого реселлерский хостинг?

    По большей части реселлерский хостинг предназначен для агентств, веб-дизайнеров и веб-разработчиков.Это люди, у которых уже есть клиенты в этом пространстве, поэтому они могут просто добавить веб-хостинг к услугам, которые они в настоящее время предлагают.

    Вы можете упростить жизнь своих клиентов, позволив им получить все потребности своего веб-сайта в одном месте, вместо того, чтобы искать план веб-хостинга самостоятельно.

    Одно из главных достоинств реселлера — это устойчивость. Если вы разрабатываете веб-сайт для кого-то, ему не обязательно навсегда понадобятся ваши услуги. Но если вы сможете заставить этих клиентов покупать у вас услуги веб-хостинга, то вы получите стабильный ежемесячный доход на протяжении всего срока службы этого веб-сайта.

    Я бы не стал рассматривать хостинг для реселлеров, если вы не планируете управлять как минимум 10 различными веб-сайтами. В противном случае, вероятно, оно того не стоит.

    Плюсы реселлеров хостинга:

    • Устанавливайте неограниченные цены для ваших клиентов.
    • Получайте постоянный и стабильный доход.
    • Улучшите существующие услуги.

    Минусы реселлера хостинга:

    • Требуется много клиентов, чтобы окупить ваше время и усилия.
    • Если что-то пойдет не так, ваши клиенты обратятся к вам.

    Лучший реселлерский хостинг-провайдер — A2 Hosting

    Хостинг

    A2 известен своей скоростью, что является одной из причин, по которой я рекомендую этот хостинг для реселлеров.

    Когда вы предоставляете своим клиентам услуги white label хостинга, вы должны быть уверены, что обеспечиваете высокую производительность. Даже если технически хостинг не принадлежит вам, любые проблемы будут плохим отражением вашего личного бренда.Но с хостингом A2 ваши клиенты по-прежнему будут получать высокие показатели безотказной работы и высокую скорость загрузки на общем сервере.

    Еще одним важным преимуществом хостинга A2 является то, что WHMCS предоставляется бесплатно со всеми планами реселлера. Это обязательно понадобится для эффективного управления всеми вашими клиентами и их ресурсами. Другие хостинг-провайдеры взимают за это дополнительную плату.

    В целом, управление клиентами с помощью A2 Hosting — лучшее, что я когда-либо видел в отрасли. Вы даже можете настроить простую поддержку хостинга.

    A2 Hosting также предлагает 99.9% времени безотказной работы для вас. Так что вы можете передать это своим клиентам.

    Какой тип хостинга лучше всего подходит для вашего сайта?

    Этот ответ у всех будет разный. То, что работает для одного бизнеса, может не подойти вам.

    Все зависит от таких факторов, как тип вашего веб-сайта, необходимые ресурсы, ваш бюджет и посещаемость.

    Как только вы узнаете, что вам нужно, вы можете начать принимать решение. Я дал свои основные рекомендации по каждой категории в этом руководстве, так что это лучшее место для вас, чтобы начать поиск.

    Чтобы понять, к какой категории вы попадаете, вот краткий обзор различных типов хостинга и того, для кого они предназначены:

    • Shared Hosting — Самые экономичные планы для веб-сайтов начального уровня. — Рекомендуемый общий хост = BlueHost
    • Хостинг VPS — Для веб-сайтов, которые выросли из общего хостинга. — Рекомендуемый хост VPS = InMotion
    • WordPress Hosting — Хостинг оптимизирован для сайтов WordPress. — Рекомендуемый хост WordPress = WP Engine
    • Выделенный хостинг — Серверы корпоративного уровня для крупных веб-сайтов.- Рекомендуемый выделенный хост = HostGator
    • Облачный хостинг — Лучшее для быстрорастущих веб-сайтов. — Рекомендуемый облачный хост = Siteground
    • Реселлерский хостинг — Для агентств, веб-разработчиков и веб-дизайнеров. — Рекомендуемый хост реселлера = A2 Hosting

    Относительная устойчивость хозяев к пятнистости листьев Alternaria у сортов канолы и горчицы определяется видами Alternaria

    Оба вида Alternaria japonica и A.brassicae вызывают тяжелую пятнистость листьев альтернариоза на рапсе ( Brassica napus ) и горчице ( B. juncea ). Мы протестировали 103 сорта Brassicaceae, включая 93 австралийского рапса, девять индийских горчиц и один сорт эфиопской горчицы ( B. carinata ) в тепличных условиях, чтобы определить устойчивость хозяев к пятнистости листьев Alternaria, вызываемой A. japonica и A. brassicae с точки зрения заболеваемости (процент заболеваемости листьев,% LDI), серьезности болезни (процент пораженной площади листьев,% LAD) и дефолиации (процентный индекс опадания листьев,% LCI).Против A. japonica по трем параметрам наиболее устойчивым оказался B. napus Surpass 404 CL (% LDI 7,5,% LAD 5,0,% LCI 0). Сорта Hyola 635 CC, Oscar, AG-Outback и Rottnest с% LDI 15,6–19,4 и% LAD 12,5–15,6 также показали сильную устойчивость, а с% LCI 10. Сорта 47C02, ATR-Signal и Clancy of B. napus показал умеренный уровень устойчивости по% LDI (21,2–25,6) и% LAD (15,0–20,6), наряду с низким уровнем дефолиации (% LCI 10). Разновидности 46C03, 46C72, ATR-Cobbler и Granite TT Б.napus также показал умеренный уровень резистентности с% LDI 23,1–28,7,% LAD 18,1–20,6 и% LCI 11,2–14,4. Значимость этой устойчивости против A. japonica подчеркивается тяжелым заболеванием на B. napus Thunder TT (% LDI 78,8,% LAD 72,5,% LCI 47,5). Против A. brassicae все разновидности проявили восприимчивость; однако, B. napus ATR-Grace был наименее восприимчивым к заболеваемости (% LDI 41,2) и тяжести (% LAD 36.2), а наиболее восприимчивым оказался B.

    Оставьте комментарий